UNIVERSIDADE FEDERAL DO CEARÁ FACULDADE DE MEDICINA DEPARTAMENTO DE CIRURGIA PROGRAMA DE PÓS-GRADUAÇÃO EM CIÊNCIAS MÉDICO-CIRÚRGICAS ALINE ALMEIDA FIGUEIREDO BORSARO

Livre

0
0
91
8 months ago
Preview
Full text

  

UNIVERSIDADE FEDERAL DO CEARÁ

FACULDADE DE MEDICINA

DEPARTAMENTO DE CIRURGIA

PROGRAMA DE PốS-GRADUAđấO EM CIÊNCIAS MÉDICO-CIRÚRGICAS

ALINE ALMEIDA FIGUEIREDO BORSARO

  

PERDA DA INTEGRIDADE MUCOSA LARÍNGEA IN VITRO INDUZIDA POR

SOLUđấO ÁCIDA CONTENDO ÁCIDO BILIAR EM CAMUNDONGOS. EFEITO

PROTETOR DA GOMA DE CAJUEIRO.

  ALINE ALMEIDA FIGUEIREDO BORSARO PERDA DA INTEGRIDADE MUCOSA LARÍNGEA IN VITRO INDUZIDA POR

  SOLUđấO ÁCIDA CONTENDO ÁCIDO BILIAR EM CAMUNDONGOS. EFEITO PROTETOR DA GOMA DE CAJUEIRO

  Tese apresentada ao Programa de Pós- Graduação em Ciências Médico-Cirúrgicas do Departamento de Cirurgia da Universidade Federal do Ceará como parte dos requisitos para obtenção do título de doutor em cirurgia.

  Orientador: Prof. Dr. Marcellus Henrique Loiola Ponte de Souza.

  ALINE ALMEIDA FIGUEIREDO BORSARO PERDA DA INTEGRIDADE MUCOSA LARÍNGEA IN VITRO INDUZIDA POR

  SOLUđấO ÁCIDA CONTENDO ÁCIDO BILIAR EM CAMUNDONGOS. EFEITO PROTETOR DA GOMA DE CAJUEIRO

  Tese apresentada ao Programa de Pós- Graduação em Ciências Médico-Cirúrgicas do Departamento de Cirurgia da Universidade Federal do Ceará como parte dos requisitos para obtenção do título de doutor em cirurgia.

  Aprovada em: 20/01/2017.

  BANCA EXAMINADORA ________________________________________________________

  Prof. Dr. Marcellus Henrique Loiola Ponte de Souza (Orientador) Universidade Federal do Ceará (UFC)

  ________________________________________________________ Prof. Dr. Luiz João Abrahão Junior

  Universidade Federal do Rio de Janeiro (UFRJ) ________________________________________________________

  Prof. Dr. João Aragão Ximenes Filho

  A Deus.

  

AGRADECIMENTOS

Ao Coordenador do programa de Pós-Graduação em Cirurgia da UFC, Prof. Dr.

  Lusmar Veras, que em meio a tantas atividades didáticas, científicas e cirúrgicas, conduz com tamanha habilidade a árdua tarefa de coordenar inúmeros alunos, mantendo a boa qualidade de nossa pós-graduação.

  Ao CNPq, pelo incentivo financeiro tão necessário ao desenvolvimento desta pesquisa. Ao meu eterno professor e orientador Ronaldo Albuquerque Ribeiro, responsável pelo meu apreço e respeito pela farmacologia desde a graduação. Foi grande incentivador em minha primeira experiência no ensino através de atividades de monitoria em sua disciplina e o responsável pela minha decisão de seguir até o doutorado. Pude sentir seus conselhos e orientações mesmo quando você já não estava entre nós.

  Ao Prof. Dr. Marcellus Henrique Ponte Loiola de Souza, por gentilmente ter me adotado como sua aluna após a partida do Prof. Ronaldo. Com competência, sabedoria e tranqüilidade, motivou-me diariamente, fazendo-me crer que havia uma “luz no fim do túnel”.

  À Profa. Dra. Ana Paula Macedo e ao Lucas Nicolau, minha adorável e inseparável equipe de pesquisa, pela ajuda e suporte logístico e emocional nesse período. A Larisse Lucetti, Gabriela Ponte, Natália Caminha, Francisco José Batista Lima,

  Rodrigo da Ponte, Mariana Nour e Marina Custódio, pela ajuda na realização dos experimentos.

  À Profa. Dra. Deysi Wong e ao Prof. Dr. Roberto Lima, por serem meus exemplos de competência, dedicação e simplicidade nas atividades de ensino e pesquisa. Ao Prof. Dr. Armênio Aguiar dos Santos, por ter cedido o laboratório para realização dos experimentos, trazendo sempre um comentário enriquecedor para o trabalho ou mesmo para a vida.

  Ao Prof. Dr. Pedro Marcos Gomes Soares, pela valiosa ajuda com as avaliações

  A Luciene e Magda, secretárias da Pós-Graduação, que com carinho e dedicação organizam todas as tarefas burocráticas, permitindo que os alunos tenham mais tempo para se dedicar ao estudo e pesquisa.

  Aos meus pais, Eugênia e Edízio, por serem meus maiores incentivadores e meus exemplos de pessoas trabalhadoras. É de vocês o mérito por eu ter chegado até aqui. Ao Rodolfo Borsaro, por dividir comigo a vida, tanto pessoal como profissional. Sem sua ajuda, assumindo parte das minhas funções de mãe, de médica e de dona de casa, não teria conseguido. O mérito também é seu.

  Aos meus irmãos, Marcelo, Luciana, Leandro e Natália, por acreditarem em mim e entenderem minhas ausências. O amor de vocês é fundamental. À Regina Borsaro, por não medir esforços para vir de Ribeirão Preto me ajudar com meus pequenos, trazendo a paz e tranquilidade de que tanto precisei nesse período. Aos meus amigos e aos colegas de trabalho, que por tantas vezes compreenderam minhas limitações em decorrência desse período de estudo, permanecendo ao meu lado e torcendo para que tudo desse certo.

  

RESUMO

  INTRODUđấO: A doença do refluxo farắngo larắngeo (DRLF) é uma manifestação extraesofágica da doença do refluxo gastroesofágico (DRGE). A despeito da alta prevalência e impacto, inexiste consenso quando a sua fisiopatologia, diagnóstico e tratamento. OBJETIVO: Este estudo objetivou avaliar o efeito de soluções ácidas associadas à pepsina e/ou ácido biliar sobre a resistência elétrica transepitelial (RETE), permeabilidade transepitelial, expressão gênica de proteínas de junção epitelial e proteínas da via apoptótica na laringe de camundongos, bem como investigar possível efeito protetor tópico da goma de cajueiro nestas alterações. MÉTODO: Laringes de camundongos foram submetidas ao contato com diferentes soluções contendo pepsina e ácido biliar em diferentes pH, sendo a RETE avaliada em câmara de Ussing. Posteriormente, foi avaliado o efeito na RETE da laringe após o contato com pepsina ou ácido biliar em pH fracamente ácido (pH 5), ou após o desafio com diferentes concentrações e tipos de ácidos biliares. Foi determinado, ainda, o efeito de solução fracamente ácida (pH 5) com ácido taurodesoxicólico (TDCA) na permeabilidade transepitelial laríngea à fluoresceína e na expressão gênica de proteínas de junção e proteínas da via apoptótica por PCR e, por fim, avaliado possível efeito protetor tópico da goma de cajueiro nestas alterações. RESULTADOS: Observou-se que a queda na RETE laríngea depende do pH, quando se utilizou solução contendo pepsina e ácido biliar, persistindo a queda com o pH 5. A exposição da mucosa laríngea à solução com pH 5 contendo ácido biliar, independente da presença de pepsina, promoveu queda da RETE laríngea. O desafio com ácido biliar numa solução com pH 5 na laringe aumentou a permeabilidade transepitelial e causou upregulation na expressão gênica de proteínas do complexo juncional, associada a um aumento na expressão gênica de proteínas pró apoptóticas. Por fim, foi detectado efeito preventivo da goma de cajueiro na queda de RETE e aumento da permeabilidade transepitelial na laringe. CONCLUSÃO: Pode-se sugerir que soluções fracamente ácidas na presença de ácidos biliares desencadeiam perda da barreira epitelial laríngea decorrente de alteração das

  

ABSTRACT

  INTRODUCTION: Laryngopharyngeal reflux disease (LPR) is an extraesophageal manifestation of gastroesophageal reflux disease (GERD). Despite the high prevalence and impact, there is no consensus concerning its pathophysiology, diagnosis and treatment. OBJECTIVE: This study aims to evaluate the effect of acid solutions associated with pepsin and/or bile acid on the transepithelial electrical resistance (TEER), transepithelial permeability, gene expression of epithelial junction proteins and proteins of the apoptotic pathway in laryngeal mucosa and to investigate a possible topic protective effect of cashew gum in these changes. METHODS: Murine larynges were exposed to contact with different solutions containing pepsin and bile acid at different pH and TEER was measured by Ussing chamber apparatus. Subsequently, we measured the effect of a weakly acidic solution (pH 5) containing pepsin or bile acids (in different concentrations and types) on laryngeal TEER. Then, it was determined the effect of a weakly acid solution (pH 5) containing taurodeoxycholic acid (TDCA) in transepithelial laryngeal permeability to fluorescein and gene expression of junction proteins and proteins of the apoptotic pathway by PCR and, finally, it was evaluated a possible topic protective effect of 10% cashew gum in these changes. RESULTS: It was observed that the decrease in the laryngeal TEER depends on the pH, when using solution containing pepsin and bile acid, but it still drops with pH 5. The exposure of the laryngeal mucosa to the solution at pH 5 containing bile acid, despite the presence of pepsin, promoted a decrease in laryngeal TEER. The challenge with bile acid in solution at pH 5 in the larynx increased transepithelial permeability and caused upregulation of gene expression of junctional complex proteins associated with an increase of gene expression of pro apoptotic proteins. Finally, the preventive effect of CG was detected in the reduction of TEER and in the increase of laryngeal transepithelial permeability. CONCLUSIONS: We can suggest that weakly acidic solutions in the presence of bile acids trigger a loss of laryngeal epithelial barrier resulting from an impairment of epitelal junction

  LISTA DE ABREVIATURAS E SIGLAS

  BIOTEC Núcleo de Pesquisas em Biodiversidade e Biotecnologia cm centímetro DCA Ácido desoxicólico DRGE Doença do refluxo gastroesofágico DRLF Doença do refluxo faringolaríngeo ED Esôfago distal EP Esôfago proximal EPM Erro padrão da média GC Goma do cajueiro GCA Ácido glicocólico

  IBP Inibidor da bomba de prótons Kg Quilograma L Laringe mg miligrama min Minutos mM Milimolar ms Milissegundos µg micrograma n Número de amostras PCR Polymerase Chain Reaction RETE Resistência elétrica transepitelial s Segundos TDCA Ácido taurodesoxicólico TUNELck end labeling

  

LISTA DE FIGURAS

   Representação gráfica da RETE laríngea após desafio ................................... 29 Figura 9

   Efeito do GCA na RETE laríngea em pH5 ...................................................... 38 Figura 17

   Efeito do DCA na RETE laríngea em pH5 ...................................................... 37 Figura 16

   Efeito do TDCA na RETE laríngea em pH5 ................................................... 37 Figura 15

   Efeito da pepsina e ácido biliar na resistência elétrica transepitelial laríngea em solução com pH5 ....................................................................................... 36 Figura 14

   Resistência elétrica transepitelial da laringe após desafio com solução de pepsina e TDCA em pH 1, 2 e 5 ...................................................................... 35 Figura 13

   Comparação da resistência elétrica transepitelial basal do esôfago proximal, esôfago distal e laringe .................................................................................... 34 Figura 12

   Protocolo para análise do efeito protetor da GC .............................................. 33 Figura 11

   Desenho esquemático do experimento para medir permeabilidade transepitelial à fluoresceína ............................................................................. 30 Figura 10

  e camara fechada com o tecido posicionado ................. 28 Figura 8

  Figura 1  Metabolismo dos Ácidos biliares ..................................................................... 17

  2

   Adaptador da câmara de Ussing com o tecido posicionado exatamente no orifício de 0.017 cm

   Laringe de camundongo .................................................................................. 27 Figura 7

   Imagem provisória da estrutura química da goma do cajueiro ........................ 26 Figura 6

  (B) .................................................................................................................... 26 Figura 5

  Figura 4  Resina extraída do troco do cajueiro(A) e goma do cajueiro após purificação

  Figura 3  Desenho esquemático das vias extrínseca e intrínseca da apoptose ................ 20

  Figura 2  Estrututa esquemática do complexo juncional ................................................ 18

   Evidências histológicas de lesão epitelial laríngea provocada pelo desafio com TDCA em meio fracamente ácido ........................................................... 39 Figura 18

  Figura 23  Expressão gênica relativa de ZO-1 .................................................................. 42

  Figura 24  Expressão gênica relativa da Claudina-3 ......................................................... 43

  Figura 25  Expressão gênica relativa de Bax .................................................................... 44

  Figura 26  Expressão gênica relativa de Caspase-3 .......................................................... 44

  Figura 27  Expressão gênica relativa de BCl-2 ................................................................. 45

  Figura 28  Efeito da Goma do Cajueiro na RETE da laringe exposta à solução de

  TDCA em pH5 por 60 minutos ....................................................................... 45 Figura 29

   Efeito da Goma do Cajueiro na RETE da laringe exposta à solução de TDCA em pH5 aos 60 minutos do desafio ...................................................... 46

  Figura 30  Efeito da Goma do Cajueiro no aumento de permeabilidade da laringe exposta à solução de TDCA em pH5 ............................................................... 47

  Figura 31  Modelo hipotético de lesão laríngea pelo ácido biliar e efeito protetor da goma do cajueiro .............................................................................................. 58

  

SUMÁRIO

  1 INTRODUđấO ......................................................................................................... 13

  

1.1 Doença do refluxo faringolaríngeo ........................................................................... 13

  

1.2 Agentes agressores no conteúdo do refluxo ............................................................. 13

1.2.1 Ácido

   ............................................................................................................................ 14

  

1.2.2 Pepsina ........................................................................................................................ 14

1.2.3 Ácido Biliar ................................................................................................................. 15

  

1.3 Barreira epitelial laríngea ......................................................................................... 17

  

1.4 Apoptose e doença do refluxo ................................................................................... 19

  

1.5 Tratamento da DRLF ................................................................................................ 20

  1.5.1 Inibidores da bomba de prótons ................................................................................. 20

  1.5.2 Tratamento tópico para DRGE .................................................................................. 21

  1.5.3 Goma de cajueiro ........................................................................................................ 22

  

2 OBJETIVOS .............................................................................................................. 23

  

2.1 Geral ........................................................................................................................... 23

  

2.2 Específicos .................................................................................................................. 23

  

3 MATERIAL E MÉTODOS ...................................................................................... 24

  

3.1 Animais ....................................................................................................................... 24

  

3.2 Aspectos éticos ............................................................................................................ 24

  

3.3 Aparelhos e instrumentos laboratoriais .................................................................. 24

  

3.4 Drogas e reagentes utilizados .................................................................................... 25

  

3.5 Extração e purificação da goma do cajueiro ........................................................... 25

  

3.6 Procedimento cirúrgico ............................................................................................. 26

  

3.7 Soluções desafio ......................................................................................................... 27

  

3.8 Resistência transepitelial ........................................................................................... 28

  

3.9 Microscopia óptica ..................................................................................................... 29

  

4.1 Resistência elétrica transepitelial basal do esôfago e da laringe ........................... 34

  

4.2 Variação da resistência transepitelial laríngea com o pH ...................................... 34

  4.3 Efeito da pepsina e ácido biliar na resistência elétrica transepitelial laríngea

bem pH fracamente

ácido............................................................................................

  35

  4.4 Efeito do ácido biliar em diferentes concentrações na resistência elétrica transepitelial laríngea em pH fracamente ácido ..................................................... 36

  

4.5 Estudo histológico da laringe exposta a TDCA em meio fracamente ácido ......... 38

  4.6 Efeito do ácido biliar na permeabilidade transepitelial laríngea em pH fracamente ácido ........................................................................................................ 39

  

4.7 Expressão gênica das proteínas de junção .............................................................. 40

  

4.8 Expressão gênica das proteínas da via apoptótica .................................................. 43

  4.9 Efeito da Goma do Cajueiro na queda da RETE laríngea promovida pelo desafio com uma solução de TDCA 5mM em pH5 ................................................. 45

  4.10 Efeito da Goma do Cajueiro no aumento da permeabilidade laríngea promovido pelo desafio com uma solução de TDCA 5mM em pH5 ..................... 46

  

5 DISCUSSÃO .............................................................................................................. 48

  

6 CONCLUSÃO ............................................................................................................ 59

REFERÊNCIAS ........................................................................................................ 60 ANEXO A

  Ố CERTIFICADO DE APROVAđấO COMITÊ DE ÉTICA ........... 65 ANEXO B Ố ARTIGO ENVIADO PARA PUBLICAđấO ................................... 66

1 INTRODUđấO

1.1 Doença do refluxo faringolaríngeo

  Doença do refluxo faríngo laríngeo (DRFL) é uma manifestação extraesofágica da doença do refluxo gastroesofágico (DRGE) na qual há refluxo do conteúdo gástrico, entrando este em contato direto com o epitélio laríngeo e faríngeo (KOUFMAN, 2002). Os sintomas mais comuns de DRLF são pigarro, tosse, disfonia e globus faríngeo (sensação de volume na garganta), sendo a DRLF apontada como fator etiológico de muitas doenças laríngeas, como laringite, estenose subglótica, carcinoma laríngeo, granulomas, úlceras de contato e nódulos vocais (CAMPAGNOLO et al., 2014). Na prática clínica otorrinolaringológica, é uma das condições mais frequentes, sendo diagnosticada em cerca de 10% dos pacientes em geral e, em pelo menos, 50% dos pacientes com queixas de distúrbios na voz (KOUFMAN, 2002). Há relato de aumento de 500% nas consultas ao otorrinolaringologista devido ao refluxo entre 1990 e 2001 (ALTMAN et al., 2005). Diante dessa expressiva prevalência, um grande número de estudos tem sido publicado na literatura médica nos últimos anos, mas inúmeras controvérsias ainda persistem, sobretudo relacionadas à fisiopatologia, diagnóstico e tratamento.

  A combinação de sintomas e achados laringoscópicos, as vezes complementada pela pHmetria, continua sendo o método diagnóstico mais utilizado, contudo, tem sido considerada cada vez mais não específica. Há relatos de que sintomas e achados laringoscópicos normalmente associados ao DRLF são também encontrados em cerca de 90% do controle sadio e ainda não há consenso de qual é o pH laríngeo considerado alterado na pHmetria, sendo um fraco indicador da gravidade dos sinais e sintomas em pacientes afetados. Tendo em vista tamanha controvérsia, tem sido indicado tratamento empírico com inibidor de bomba de prótons (IBP) como método diagnóstico alternativo (CAMPAGNOLO et al., 2014).

  1.2

  1.2.1 Ácido

  O lúmen da faringe e da laringe apresenta um pH neutro, em torno de 7, enquanto o conteúdo gástrico apresenta pH 2 (WOOD et al., 2011). A regurgitação do conteúdo gástrico atingindo a via aérea superior leva a uma expressiva queda no pH faringolaríngeo.

  O ácido foi historicamente considerado o agente agressor principal do refluxo gastroesofágico. Acreditava-se que seria necessário um pH abaixo de 4 por um tempo significativo em contato à mucosa esofágica para que houvesse lesões decorrentes do refluxo (PEARSON et al., 2011). Trabalhos mais recentes, no entanto, comprovam danos esofágicos em pH fracamente ácido, fazendo levantar a possibilidade de que outros componentes do suco gástrico refluído podem ser tão ou mais lesivos à mucosa esofágica quanto o ácido (FARRÉ 2008; PARDON et al., 2016).

  et al.,

  Trabalhos experimentais utilizando laringes suínas demonstram queda na resistência transepitelial laríngea (RETE) e danos teciduais após exposição a soluções ácidas por 30 minutos (BULMER et al, 2010; ERICKSON; SIVASANKAR, 2010). A ação exata do ácido na laringe, no entanto, é pouco conhecida. Alguns estudos sugerem que a combinação de ácido e pepsina é necessária para causar lesão (JOHNSTON et al., 2012), principalmente no pH fracamente ácido (ERICKSON; SIVASANKAR, 2010). Utilizando a associação de pHmetria e impedanciometria em pacientes com sintomas nítidos de DRLF, trabalho de Samuels et al. (2009) mostrou que muita dessa sintomatologia correpondia a refluxo não ácido, sugerindo clinicamente, que outros componentes do refluxato, como pepsina e ácido biliar, podem causar dano à mucosa laríngea.

1.2.2 Pepsina

  Pepsina é uma protease acídica que tem atividade máxima em pH entre 1.9 e 3.6, mas mantém atividade mensurável até pH 6 (JOHNSTON et al., 2007a). Apesar de inativa em

  o danos intracelular mesmo que o meio luminal contenha apenas pepsina inativa (JOHNSTON, ., 2007b).

  et al

  Erickson e Sivasankar (2010), utilizando laringe suína, demonstraram necessidade de meio ácido para a pepsina comprometer a barreira epitelial laríngea, não havendo alterações teciduais quando pepsina é utilizada em pH neutro (pH 7). Estudos utilizando cultura de células hipofaríngeas humanas expostas à pepsina em pH 7,4, no entanto, mostram aumento de expressão de citocinas e receptores pró inflamatórios, sugerindo que a pepsina refluída pode contribuir para a inflamação laríngea associada com o refluxo gástrico não ácido, como o que ocorre em pacientes sob terapia de supressão ácida (SAMUELS; JOHNSTON, 2009). Não há, portanto, um consenso sobre a exata faixa de pH em que a pepsina pode ser lesiva para a mucosa laríngea.

  A fisiopatologia da lesão laríngea promovida pela pepsina ainda é incerta, mas estudos associam a presença de pepsina no tecido com a diminuição de proteínas protetoras, como anidrase carbônica e E-caderina (JOHNSTON et al., 2004, GILL et al., 2005). Vale ressaltar que os autores delegam a depleção dessas proteínas à presença de pepsina e não exclusivamente em resposta ao baixo pH, sugerindo, portanto, um papel específico para a pepsina na lesão laríngea.

  A pepsina tem sido detectada em saliva e secreção da orelha média de pacientes com sintomas de DRLF em concentrações maiores que aqueles sem sintomatologia sugestiva (FORMÁNEK et al., 2015; SEREG-BAHAR et al., 2015). A detecção da pepsina em tais fluidos pode ser realizada através de método rápido e não invasivo, como o peptest (peptest, RDBiomed limited, Hull, UK), ensaio imunoenzimático, contendo anticorpos monoclonais anti-pepsina humana, tornando pepsina um importante marcador de DRGE e refluxo extra esofágico (HAYAT et al., 2015; SIFRIM, 2015).

  1.2.3 Ácido biliar

  Os ácidos biliares são sintetizados pelos hepatócitos através do metabolismo do colesterol, sendo o principal componente da bile (KLOKKENBURG et al., 2009). Eles existem na forma de ácido livre, conjugado com glicina ou taurina, ou ainda na forma de sal biliar com sódio ou potássio. Os dois ácidos biliares primários são o ácido cólico e o quenodesoxicólico, que, no cólon, sob ação de bactérias, são convertidos em ácidos biliares secundários desoxicólico (DCA) e litocólico. Uma vez absorvidos, os ácidos biliares livres são conjugados por glicina ou taurina [ácido glicocólico (GCA), taurodesoxicólico (TDCA), entre outros]. Nas condições alcalinas da bile hepática, tanto os ácidos biliares livres quanto conjugados são convertidos em sais de sódio ou potássio (PEARSON et al., 2011) (Figura 1). Em humanos, os ácidos biliares livres perfazem menos de 2% dos ácidos biliares no lúmen intestinal, estando a maioria (98%) na forma conjugada com glicina ou taurina (McQUAID et

  , 2011). Pacientes em uso de IBP, no entanto, tendem a apresentar pH gástrico e esofágico

  al

  fracamente ácido e aumento no crescimento bacteriano gástrico, favorecendo a desconjugação de ácidos biliares e consequente aumento em sua forma não conjugada (THEISEN et al, 2000).

  Revisão sistemática visando elucidar o papel do ácido biliar na DRGE analisou diversos artigos que detectaram ácido biliar no conteúdo de aspirado esofágico de pacientes com DRGE. A concentração de ácido biliar em pacientes com DRGE foi demonstrada ser significativamente maior em pacientes com esta afecção do que em controles assintomáticos, sendo a diferença ainda maior em período pós-prandial. A mesma revisão concluiu ser o ácido biliar o responsável por desencadear sintomas de DRGE, como pirose e dor torácica, especialmente se presente em altas concentrações ou em associação com ácido. Além disso, através de estudos in vitro, concluiu que os ácidos biliares podem estimular células epiteliais esofágicas a secretarem quimiocinas pró inflamatórias, causando estresse oxidativo, dano ao DNA e indução de apoptose nas mesmas células escamosas esofágicas (McQUAID et al., 2011). Estudo de Pardon et al. (2016), utilizando modelo de perfusão esofágica em coelhos, demostrou que uma solução fracamente ácida contendo DCA pode alterar a integridade

  A despeito de várias investigações visando esclarecer a ação dos ácidos biliares no esôfago, pouco se encontra na literatura a respeito do papel e ação destes na mucosa laríngea. Um dos poucos estudos é o de Sasaki et al. (2005) que, utilizando laringe de ratos, baseou-se em critérios histológicos para demonstrar que solução ácida (pH 1,5) e fracamente ácida (pH 5) contendo TDCA e solução com pH neutro (pH 7,4) contendo o ácido não conjugado quenodesoxicólico promovem inflamação epitelial laríngea, sugerindo que os ácidos biliares podem causar lesões tanto em meio ácido quanto não ácido.

  Não se encontrou, na literatura pesquisada, descrição de efeito dos ácidos biliares na laringe em humanos, nem estudos experimentais que determinem o mecanismo da lesão laríngea causada pelos ácidos biliares.

  Figura 1

  • – Metabolismo dos Ácidos biliares Fonte: Mcstrother (2012).

1.3 Barreira epitelial laríngea

  junções aderentes (adherens junctions), que ancoram as células epiteliais uma às outras, conferindo força mecânica à barreira epitelial (NEUNLIST et al., 2013). As principais proteínas do complexo juncional são claudina, ocludina (tigh junctions) e e-caderina (adherens junctions) (PEARSON et al., 2011) (Figura 2).

  Figura 2

  • Estrututa esquemática do complexo juncional Fonte: Levendoski et al. (2015).

  No esôfago, diversos estudos demonstram alterações na barreira epitelial secundária à ação de componentes do refluxato, indicados mediante alterações na RETE, permeabilidade e indução de alargamento do espaço intercelular, visto por microscopia eletrônica de transmissão (FARRÉ et al., 2008; GHATAK et al., 2016; PARDON et al., 2016). Artigo de revisão concluiu, através de modelos esofágicos simulando refluxo, que a alteração no complexo juncional é o principal fator causal para o aumento na permeabilidade paracelular, levando íons ao espaço intercelular e, consequentemente, criando uma força osmótica para o movimento de água. Esse aumento no movimento de água para o espaço intercelular separa as células lateralmente, produzindo dilatação deste espaço (TOBEY et al., promovida pelo conteúdo gástrico refluído. A anidrase carbônica é uma enzima que catalisa a hidratação do dióxido de carbono, produzindo bicarbonato, que neutraliza o refluxo ácido no espaço extracelular, sendo considerado um dos principais mecanismos protetores contra a ação do refluxo ácido no esôfago (TOBEY et al., 1989). Estudos demonstram diminuição significativa da expressão da anidrase carbônica III na região dos ventrículos e pregas vocais, na presença de refluxo faringolaríngeo, ampliando ainda mais a susceptibilidade laríngea à ação lesiva do ácido (JOHNSTON et al., 2004). Adicionalmente, mucinas são consideradas protetoras da mucosa contra a ação do refluxo na laringe e também apresentam expressão diminuída neste orgão na presença de refluxo faringolaríngeo (WOOD et al., 2011).

1.4 Apoptose e doença do refluxo

  Morte celular programada, ou apoptose, é considerada componente vital de vários processos, incluindo turnover celular normal, adequado funcionamento e desenvolvimento do sistema imunológico, desenvolvimento embriogênico e morte celular induzida por químicos. Apoptose inapropriada é fator causal de várias condições como doenças neurodegenerativas, dano isquêmico, doenças autoimunes e muitos tipos de câncer. Existem duas vias apoptóticas principais: a via extrínseca, via desencadeada por ativação de receptores transmembrana, culminando com ativação de caspase-8, e a via intrínseca ou mitocondrial, na qual estímulos causam alterações na membrana mitocondrial, liberação de proteínas pró apoptóticas para o citoplasma e ativação da caspase-9. Ambas as vias convergem para a via executora, que é iniciada pela clivagem da caspase-3, dando início à série de eventos que culminam com a morte celular (Figura 3). O controle e regulação dos eventos mitocondriais ocorrem através de membros da família Bcl-2, que podem ter características pró apoptóticas (Bax, Bid, Bcl-10, Bak, entre outras) ou anti apoptóticas (Bcl-2, Bcl-x, Bcl-XL, etc), determinando se há continuidade do processo apoptótico ou se o processo é abortado (ELMORE, 2007).

  Um dos mecanismos propostos para explicar à quebra de barreira epitelial na Figura 3

  • – Desenho esquemático das vias extrínseca e intrínseca da apoptose Fonte: Clarke e Tyler (2009).

1.5 Tratamento da DRLF

  A associação de dieta, mudança de hábitos e uso de inibidores de bomba de prótons é o tratamento atualmente preconizado para DRLF (CAMPAGNOLO et al., 2014).

1.5.1 Inibidores de bomba de prótons

  Os IBP são fármacos que suprimem a produção ácida ao agirem diretamente na

  H / K ATPase das células parietais (CAMPAGNOLO et al., 2014). Eles não só promovem a comparável ao placebo. A causa de tamanha variabilidade é delegada à falha nos critérios diagnósticos, podendo incluir pacientes sem DRLF, à dificuldade de padronização da dose e duração do tratamento e, sobretudo, ao fato dos IBP apenas reduzirem o volume do refluxo ácido e, por isso, a ação da pepsina, mantendo, no entanto, o refluxo não ácido e a ação dos demais componentes do refluxato (CAMPAGNOLO et al., 2014). Os mesmos autores mencionam a cirurgia (fundoplicatura) como uma opção de tratamento bem estabelecida em pacientes com DRGE refratários ao tratamento medicamentoso e dietético. Contudo, descrevem que, para o tratamento da DRLF refratária, pobres resultados têm sido atingidos com a cirurgia, questionando a indicação de fundoplicatura para pacientes com DRLF sem sintomas típicos de DRGE e refratários ao tratamento (CAMPAGNOLO et al., 2014).

1.5.2 Tratamento tópico para DRGE

  Alternativas terapêuticas têm sido estudadas na tentativa de conduzir tamanha quantidade de pacientes refratários aos tratamentos tradicionais. Soluções de alginato, frequentemente usadas no tratamento de DRGE, agem de forma mecânica ao reagir com o ácido gástrico, formando um gel que, em combinação com o gás carbônico formado, o conduz para regiões mais proximais do estômago, ocupando a superfície do bolo alimentar, na região da junção gastroesofágica. O alginato possui ainda a capacidade de bloquear o chamado “acid

  pocket

  ”, que consiste no “bolsão ácido” que se forma logo acima do bolo alimentar, sendo considerado um dos fatores responsáveis pela maior ação lesiva do HCl na DRGE complicada e nos indivíduos com sintomas de controle mais difícil (BARBUTI, 2011). Mecanismo adicional de ação do alginato foi proposto por estudos recentes com biópsia de esôfago e cultura de células esofágicas, indicando que uma solução de alginato, aplicada topicamente, promove aderência na mucosa esofágica capaz de proteger contra as lesões mucosas provocadas pelo ácido biliar em meio ácido, sugerindo ser o alginato capaz de agir como um protetor mucoso tópico. O estudo levanta a possibilidade teórica de que soluções de alginato

1.5.3 Goma de Cajueiro

  Gomas, como celulose e alginato são polissacarídeos. Diferem um dos outros na estrutura, mais precisamente na configuração química e no modo como as unidades monoméricas são unidas. Elas têm composição e propriedades típicas que dificilmente podem ser mimetizadas por polímeros sintéticos e que as tornam ideais para muitas aplicações dentro da indústria alimentar e farmacêutica, especialmente pelo baixo custo, baixo risco de efeitos colaterais, biocompatibilidade e disponibilidade local (RIBEIRO et al., 2016).

  A goma do cajueiro (GC) é um polissacarídeo derivado da árvore Anacardium

  

occidentale L. , membro da família Anacardiaceae, a qual é abundante no nordeste do Brasil,

  podendo ser extraída fazendo-se incisões no tronco ou ramos da árvore (DE PAULA; HEALTHY; BUDD, 1998). A média de produção no Brasil é de 700g/árvore/ano, com potencial de produção de cerca de 50000 toneladas/ano (CUNHA; PAULA; FEITOSA, 2009).

  Em decorrência de suas propriedades adesivas na mucosa, a GC tem sido utilizada como excipiente para medicações que necessitem bioadesividade (RIBEIRO et al., 2016). Estudos indicam que a GC tem efeito gastroprotetor contra lesão gástrica induzida por naproxeno em ratos (CARVALHO et al., 2015) e efeito antidiarréico em modelos de diarréia inflamatória e secretória aguda (ARAÚJO et al., 2015). Estudo de pesquisadores do nosso grupo avaliou o efeito da GC 5%, aplicada topicamente, em biópsias esofágicas humanas submetidas ao contato com solução ácida com pepsina e ácido biliar e demonstrou que a GC 5% promoveu efeito protetor contra a queda da RETE decorrente da exposição à solução desafio (DE LIMA et al., 2016).

  Além de suas propriedades protetoras do sistema gastrointestinal descritas acima, particular interesse na GC advém do fato de ser um produto natural, biodegradável e com baixo custo, apresentando grande potencial como alternativa ao tratamento da DRGE e DRLF.

2 OBJETIVOS

  2.1 Geral

  Estudar o efeito do ácido biliar na integridade da mucosa laríngea de camundongos, bem como investigar possível efeito protetor da goma de cajueiro.

  2.2 Específicos

   Comparar a RETE basal laríngea com a do esôfago proximal e distal em camundongos.

   Testar o efeito de soluções com diferentes pH, associada a pepsina e ácido biliar na barreira epitelial funcional laríngea, através da medida de RETE.

   Avaliar, separadamente, o efeito da pepsina e do ácido biliar em solução fracamente ácida na RETE laríngea.

   Utilizar o pH fracamente ácido para avaliar o efeito de diferentes ácidos biliares em diferentes concentrações na RETE laríngea.

   Estudar o efeito do ácido biliar na morfologia e permeabilidade transepitelial laríngea, bem como na expressão gênica de proteínas de junção epitelial e proteínas da via apoptótica.  Investigar possível efeito protetor tópico da goma de cajueiro em tais alterações.

3 MATERIAL E MÉTODOS

  3.1 Animais

  Foram utilizados camundongos Swiss machos, pesando entre 20 e 30g, fornecidos pelo biotério do Departamento de Cirurgia da Faculdade de Medicina da Universidade Federal do Ceará (UFC) e colocados em caixas, em um ambiente com temperatura de 22 ±

  o

  2 C num ciclo de 12h claro/12h escuro, com livre acesso a água e ração padrão (Purina Chow). Para todos os experimentos foram utilizados 116 animais.

  3.2 Aspectos éticos

  Os experimentos foram realizados de acordo com o Guia de Cuidados e Usos de Animais de Laboratório, estabelecidos pelo Colégio Brasileiro de Experimentação Animal (COBEA) e o projeto foi aprovado pelo Comitê de Ética em Pesquisa Animal da UFC, sob protocolo 23/2016.

  3.3 Aparelhos e instrumentos laboratoriais

   Agitador magnetico 752 Fisatom  Câmara de Ussing (Mussler Scientific Instruments, Aachen, Germany)  Eppendof centrifuge 5804 R  Espectrofotômetro Nanodrop 2000 (Thermo scientific)  Fluorímetro Fluostar optima (BMG labtech. Ontemberg, Germany  Lupa (Leica LED2500, Leica Microsystems)  Step One Plus (Real-time PCR system)  Balança Analítica de precisão Mettler Toledo

   Ponteiras para pipetas automáticas Sigma  Seringas (B-D Plastipak)  Vidrarias

  3.4 Drogas e reagentes utilizados

   TDCA (ácido taurodesoxicólico) – Utilizado na forma do sal taurodesoxicolato sódico (Sigma Aldrich)  DCA (ácido desoxicólico) – Utilizado na forma do sal desoxicolato sódico monoidratado (Sigma Aldrich)  GCA (ácido glicocólico) - Utilizado na forma do sal glicocolato sódico (Sigma

  Aldrich)  Pepsina – pepsina da mucosa gástrica porcina 250 unidades/mg de sólido

  (Sigma Aldrich)  Fluoresceína – 375 Da (Sigma Aldrich)

  3.5 Extração e purificação da goma do cajueiro

  Amostras brutas de goma do cajueiro (GC) foram coletadas pelo Núcleo de Pesquisa em Biodiversidade e Biotecnologia (BIOTEC), Parnaíba-PI, Brasil, a partir do tronco de árvores de caju nativas (Anacardium occidentale L.), no município de Ilha Grande de Santa Isabel, Piauí, Brasil (Latitude, graus decimais S -2,8242; Longitude, graus decimais W-41,7331). A árvore foi identificada e o espécime recebeu o comprovante de número 52, sendo depositado no herbário HDELTA (Universidade Federal do Piauí, Parnaíba, Piauí, Brasil). Nódulos do caule foram selecionados e dissolvidos em água destilada à temperatura ambiente para dar origem a uma solução de 5% (peso/volume). O pH da solução foi ajustado para aproximadamente 7.0 por adição de NaOH. A solução límpida foi sucessivamente

  Figura 4

  • – Resina extraída do troco do cajueiro(A) e goma do cajueiro após purificação (B)

  A B Fonte: Ribeiro et al. (2016).

  Figura 5

  • – Imagem provisória da estrutura química da goma do cajueiro Fonte: Ribeiro et al. (2016).

3.6 Procedimento cirúrgico

  Os animais foram profundamente anestesiados com injeção intraperitoneal de Quetamina (100mg/Kg) + Xilazina (10mg/Kg) e eutanasiados por exsanguinação através de secção da aorta abdominal. Em seguida, foi realizado cervicotomia, identificação de laringe, dissecção e remoção da mesma que foi então colocada numa placa de Petri com solução de

  Figura 6

  • – Laringe de camundongo

  A B Epiglote

  A

B

Pregas Vocais Comissura Anterior

  Fonte: próprio autor.

A laringe foi aberta longitudinalmente em sua região posterior, identificando-

se epiglote, pregas vocais e comissura anterior (região estudada).

  Para os experimentos que visaram o estudo adicional da resistência basal do esôfago, um fragmento proximal e outro distal do esôfago foram removidos pela mesma cervicotomia, logo após a remoção da laringe, e também colocados em uma placa de Petri com solução de Krebs para dissecção com utilização da lupa. A musculatura do esôfago foi removida e a mucosa aberta longitudinalmente.

3.7 Soluções desafio

  A mucosa laríngea foi exposta a uma das seguintes soluções desafio para análise dos parâmetros de dano epitelial: 1- Solução de Krebs pH 1 + pepsina 1mg/ml + TDCA 2mM 2- Solução de Krebs pH 2 + pepsina 1mg/ml + TDCA 2mM 3- Solução de Krebs pH 5 + pepsina 1mg/ml + TDCA 2mM 4- Solução de Krebs pH 5 + pepsina 1mg/ml 5- Solução de Krebs pH 5+ TDCA 2mM 6- Solução de Krebs pH 5 7- Solução de Krebs pH 5 + TDCA 0.5mM

  14- Solução de Krebs pH 5 + GCA 5 mM 15- Solução de Krebs pH 7

3.8 Resistência transepitelial

  Após dissecção, a laringe foi imediatamente montada numa câmara de Ussing (Mussler Scientific Instruments, Aachen, Germany) adaptada, com a região da comissura

  2

  anterior exatamente no orifício de 0.017cm do adaptador (Figura 7). Para os experimentos que visavam avaliação simultânea da resistência epitelial basal esofágica, o fragmento de esôfago proximal e distal, após dissecção, foram montados em câmara de Ussing semelhante. Todas as câmaras de Ussing com os tecidos foram preenchidas com 3.5ml de solução de Krebs (NaCl 118mM + KCl 4.7mM + MgSO 1.2mM + CaCl 1.2mM + NaH PO 1.2mM +

  

4

  2

  2

  4 NaHCO 3 25mM + Glicose 11.1mM) com pH 7.4 para registrar a resistência transepitelial

  basal, calculada de acordo com a lei de Ohm através das alterações de voltagem induzidas por pulsos de corrente bipolares de 50 µA, duração de 200 ms a cada 6 s, aplicada através de fios de platina. Todos os experimentos foram realizados em circuitos abertos.

  Figura 7

  • – Adaptador da câmara de ussing com o tecido posicionado

  2

  exatamente no orifício de 0.017 cm (A) e camara fechada com o tecido posicionado (B).

  B A Fonte: próprio autor. Figura 8

  • – Representação gráfica da RETE laríngea após desafio Fonte: próprio autor.

  3.9 Microscopia óptica

  Para o estudo histológico, após o desafio e gravação da RETE por 30 minutos, as laringes foram fixadas em formol 10% por 24 horas e, em seguida, transferidas para uma solução de álcool 70%, onde permaneceram até o processamento para preparação da lâmina. Neste momento, o material foi embebido em parafina, realizado cortes de 5µm que foram colocados em lâminas e corados com hematoxilina e eosina para estudo no microscópio óptico.

  As laringes submetidas ao desafio com TDCA 5mM em pH5 e as do grupo controle foram analisadas de forma cega por examinador experiente (P.M.G.S.), sendo avaliados os seguintes critérios: descamação epitelial, erosão epitelial, edema celular epitelial, retração epitelial e edema intersticial. Os critérios foram baseados em achados histopatológicos de estudos prévios que avaliaram o efeito de soluções que mimetizam o refluxo gástrico na mucosa laríngea (ERIKSON; SIVASANKAR, 2010).

  3.10 Permeabilidade transepitelial utilização da solução de fluoresceína o ambiente foi mantido escuro para evitar degradação da mesma. A permeabilidade do tecido à fluoresceína foi calculada a partir da medida de fluoresceína na amostra mediante uso de um fluorímetro (Fluostar optima, BMG labtech. Ontemberg, Germany) e expressa na forma de razão de intensidade de fluorescência, dividindo-se a intensidade de fluorescência em cada tempo pela intensidade de fluorescência no tempo inicial.

  Figura 9

  • – Desenho esquemático do experimento para medir permeabilidade transepitelial à fluoresceína Fonte: próprio autor.

3.11 Análise de expressão gênica de proteínas do complexo juncional e da via apoptótica

  PCR quantitativo em tempo real foi utilizado para medir a expressão gênica de proteínas do complexo juncional (Ocludina, Claudina 1 e 3, ZO-1 e E-caderina) e proteínas da via apoptótica (Bcl-2, Bax, Caspase 3). Os Primers foram projetados com base em sequências Quadro 1

  • – Sequência de primers Mus muscullus obtidos no Banco de dados da NCBI

  Bax- Senso AAACTGGTGCTCAAGGCCCT Bax- Anti-senso AGCAGCCGCTCACGGAG

Bcl-2- Senso TTCGCAGCGATGTCCAGTCAGCT

Bcl-2- Anti-senso TGAAGAGTTCTTCCACCACCGT

casp3- Senso AACCAGATCACAAACTTCTGCAAA

casp3- Anti-senso TGGAGTCCAGTGAACTTTCTTCAG

  ZO-1 Senso GACCATCGCCTACGGTTTGA ZO-1 Anti-Senso AGGTCTCGGGGATGCTGATT Ocludina- Senso AAGAGCAGCCAAAGGCTTCC Ocludina- Anti-senso CGTCGGGTTCACTCCCATTA Claudina-1 Senso TCTACGAGGGACTGTGGATG Claudina-1 Anti-senso TCAGATTCAGCAAGGAGTCG Claudina-3 Senso CCAAGGCCAAGATCACCATC Claudina-3 Anti-senso GGGCACCAACGGGTTATAGA E-Cadherin Senso CGTCCCCCTTTACTGCTGAG E-Cadherin Anti- TTCTGGTTATCCGCGAGCTT senso Fonte: Próprio autor.

  Amostras da laringe foram removidas da câmara de Ussing após 60 minutos de desafio com solução de TDCA 5mM em meio fracamente ácido (pH 5) e armazenadas a

  o

  • 80 C até a realização do ensaio, quando foram trituradas mediante homogeneização vigorosa em 300 mg de glassbeads de 0,1 mm (BioSpec, Bartlesville, OK, EUA) utilizando MiniBeadBeater (BioSpec).

  A extração do RNA total foi realizada em cada uma das amostras utilizando o kit de extração

  Aurum™ Total RNA FattyandFibrousTissue (Bio-Rad, CA, USA). A quantidade Transcriptase reversa utilizando o kit de síntese iScript™ (Bio-Rad) no termociclador C1000 Touch™.

  Ensaios de PCR em tempo real foram realizadas em um volume final de 20 µL contendo 10 µL de supermixiQTM SYBR® Green, 2 µL de cada primers (200 nM), 1µL de cDNA das amostras e 5 µL de água livre de RNAase. Controles negativos também foram testados, com o cDNA sendo substituídos por água livre de RNAase. Todas as amostras foram processadas em duplicata. As condições de PCR foram as seguintes: um período de desnaturação inicial a 95°C/7min, seguido por 45 ciclos de amplificação gênica. Cada ciclo consistiu de uma fase de desnaturação inicial a 95°C/20s, seguida por uma fase de anelamento a 60°C/20s e por fim uma fase de extensão a 72°C/45s. As amostras foram então submetidos a uma etapa de extensão a72°C/3min. Para garantir a especificidade do produto de PCR, foi realizada a curva de Melting, após cada reação, em que a temperatura da reação foi posteriormente aumentada 0,5°C a cada 15s, com início na temperatura de anelamento de um primer e terminando em 95°C. Foi utilizada como gene de referência a β-actina. Todas as amplificações foram analisadas pelo sistema de detecção de PCR em tempo real CFX96 Touch™ (Bio-Rad). A expressão gênica relativa foi determinada usando o método 2-ΔΔCt (Livak).

3.12 Efeito protetor da goma do cajueiro

  Para análise do efeito da GC sobre a RETE e permeabiliadade transepitelial laríngea, o tecido foi montado na câmara de Ussing da mesma forma já descrita e, após estabilização da resistência basal, a gravação foi pausada e as câmaras foram removidas e separadas para exposição do lado luminal da laringe. Aplicou-se 200 µL da solução protetora (GC) ou de solução de Krebs (controle) no lado luminal exposto e deixou-se em contato com a mucosa por cinco minutos, após os quais a câmara, do lado mucoso, foi preenchida com 3.5mL de solução com pH 5 e TDCA 5mM para a gravação da RETE por 60 minutos, após Figura 10

  • – Protocolo para análise do efeito protetor da GC Fonte: próprio autor.

3.13 Análise estatística

  Para análise dos dados e confecção dos gráficos, foi utilizado o software

  Graphpad Prism

  6. Inicialmente, foi testada a normalidade dos dados (Shapiro Wilk) para a escolha do teste a ser utilizado. Conforme a normalidade, foram utilizados teste t ou Mann Whitney e ANOVA ou Kruskal Wallis. Nos experimentos de resistência, One-way ANOVA e teste Tukey de múltiplas comparações foram utilizados quando se comparou todos os grupos. Na análise temporal de resistência, foram utilizados two-way ANOVA e teste Bonferroni. Para análise de permeabilidade à fluoresceína, foram utilizados Mann Whitney ao se comparar dois grupos e Kruskal Wallis ao se comparar três grupos. Ao se analisar a expressão gênica das proteínas de junção e proteínas da via apoptótica, utilizou-se teste t não pareado. Os valores são expressos como média ± erro padrão da média (E.P.M), sendo considerado significativo valores de p < 0,05.

4 RESULTADOS

  4.1 Resistência elétrica transepitelial basal do esôfago e da laringe

  Na Figura 11, nota-se que a RETE basal do esôfago distal (ED) e do esôfago proximal (EP) é significativamente maior que a RETE basal da laringe (L) (ED=174.3 ± 43.08, EP=152.2 ± 33.01 e L=34.80 ± 2.78). Não há diferença estatística entre a média da RETE basal do esôfago proximal e distal.

  Figura 11

  • – Comparação da resistência elétrica transepitelial basal do esôfago proximal, esôfago distal e laringe Fonte: próprio autor.

  RETE basal do esôfago proximal (EP), esôfago distal (ED) e laringe (L). Os valores são expressos como média ± erro padrão da média. n = 4-6. * P<0.05 grupo L vs. ED e EP (One-way ANOVA e Tukey).

  4.2 Variação da resistência transepitelial laríngea com o pH

  As Figuras 12A e 12B mostram que a queda na RETE laríngea é maior com a Figura 12

  • – Resistência elétrica transepitelial da laringe após desafio com solução de pepsina e TDCA em pH 1, 2 e 5

  A B Fonte: próprio autor.

  Percentual da RETE inicial em resposta a exposição laríngea à solução de pepsina (1mg/mL) e TDCA (2mM) em diferentes pH (1, 2 e 5). (A) Avaliação temporal do

  • * percentual da RETE inicial em 1, 5, 10, 20 e 30 minutos. p<0,001 vs. controle (pH 7,4) a partir de 5 minutos (two-way ANOVA e teste Bonferroni). (B) Percentual da RETE ***
    • ** * inicial em 30 minutos. P <0,001 pH5 vs. pH7,4. P< 0,001 pH2 vs. pH5 e pH7,4.

      P <0,001 pH1 vs. pH2, pH5 e pH7,4(One-way ANOVA e teste Tukey). Os valores são expressos como média ± erro padrão da média. n =5-7. RETE quando utilizada a solução com pepsina + TDCA (32.82% ± 2.22) bem como somente TDCA (32.86% ± 3.43), não havendo, no entanto, queda na RETE ao utilizar-se a pepsina isoladamente.

      Figura 13

    • – Efeito da pepsina e ácido biliar na resistência elétrica transepitelial laríngea em solução com pH5 Fonte: próprio autor.

      Percentual da RETE inicial em resposta a exposição laríngea à solução contendo pepsina (pep) 1mg/mL, TDCA (2mM) ou pepsina + TDCA em pH5. *p<0.001 vs. controle (pH5) (One-way ANOVA e teste Tukey). Os valores são expressos como média ± erro padrão da média. n = 5 - 7.

    4.4 Efeito do ácido biliar em diferentes concentrações na resistência elétrica transepitelial laríngea em pH fracamente ácido

      As Figuras 14, 15 e 16 mostram a ação do ácido taurodesoxicólico (TDCA), desoxicólico (DCA) e glicocólico (GCA) respectivamente, em concentrações de 0.5, 2 e 5mM na RETE laríngea em uma solução fracamente ácida (pH5). O TDCA promoveu queda significativa na RETE laríngea nas concentrações de 2 e 5mM. A RETE laríngea diminuiu

      Figura 14

    • – Efeito do TDCA na RETE laríngea em pH5 Fonte: próprio autor.

      Percentual da RETE inicial após desafio com solução com TDCA nas concentrações de 0.5, 2 e 5mM em pH5. *p<0.001 TDCA # 2mM vs.controle. p<0.001 TDCA 5mM vs.controle e TDCA 2mM. (One-way ANOVA e teste Tukey). Os valores são expressos como média ± erro padrão da média. n = 5

    • – 6.

      Figura 15

    • – Efeito do DCA na RETE laríngea em pH5
    Figura 16

    • – Efeito do GCA na RETE laríngea em pH5 Fonte: próprio autor.

      

    Percentual da resistência elétrica transepitelial inicial após desafio

    com solução com GCA nas concentrações de 0.5, 2 e 5mM em

    pH5. Os valores são expressos como média ± erro padrão da

    média. n = 5.

      Tabela 2

    • – Efeito de ácidos biliares na RETE laríngea em uma solução fracamente ácida (pH5)

      Ácido taurodesoxicólico (5mM) Ácido desoxicólico (5mM) Ácido glicocólico (5mM) % Resistência inicial 50,41 ±3,49* 55,13 ±5,48* 94,97±2,18 Fonte: próprio autor.

    Percentual da resistência elétrica transepitelial inicial após desafio com solução contendo

    TDCA, DCA ou GCA na concentração de 5mM. * p<0.001 TDCA e DCA vs. GCA (One-way

    ANOVA e teste Tukey). Os valores são expressos como média ± erro padrão da média. n = 5.

    4.5 Estudo histológico da laringe exposta a TDCA em meio fracamente ácido

      As amostras estudadas foram confirmadas pelo patologista como sendo tecido

      

    Evidências histológicas de lesão mucosa laríngea após exposição ao TDCA 5mM em pH 5 por 30

    minutos (B), notando-se descamação epitelial (setas) e edema da lâmina própria (traço), comparado ao

    controle, onde não se notam tais alterações (A). Aumento 400x.

      Figura 17

    • – Evidências histológicas de lesão epitelial laríngea provocada pelo desafio com TDCA em meio fracamente ácido Fonte: próprio autor.

    4.6 Efeito do ácido biliar na permeabilidade transepitelial laríngea em pH fracamente ácido

      As figuras 18 e 19 evidenciam a mudança da permeabilidade epitelial promovida pela exposição ao TDCA na concentração de 5mM. Durante os noventa minutos, houve aumento progressivo da permeabilidade transepitelial laríngea quando o desafio foi realizado com solução de TDCA 5mM em pH5 (Figura 18), chegando a diferença significativa aos 90 minutos, quando a razão da intensidade de fluorescência sobre a intensidade de fluorescência imediatamente após a troca de solução foi 181.6 (±43.53), comparado a uma razão de 23.18 (±10.47) quando utlizado solução de Krebs (controle) (Figura 19). Figura 18

    • – Efeito do TDCA na permeabilidade transepitelial em pH5 durante 90 minutos Fonte: próprio autor.

      

    Efeito do TDCA 5mM em uma solução fracamente ácida na permeabilidade da mucosa laríngea

    * durante 90 minutos após colocação de fluoresceína. <0.01 (Mann-Whitney). Os valores são P expressos como média ± erro padrão da média. n = 5-10.

      Figura 19

    • – Efeito do TDCA em pH5 na permeabilidade transepitelial aos 90 minutos Fonte: próprio autor.

      Efeito do TDCA 5mM em uma solução fracamente ácida na permeabilidade da mucosa laríngea 90 minutos após colocação da fluoresceína. *p<0.01 (Mann Whitney). Os valores são expressos como média ± erro padrão da média. n = 5-10. ocludina, valor significativamente maior que no grupo controle (1.05 ±0.23) (Figura 20). Já a expressão gênica da Claudina-1 teve aumento de 2.72 vezes (± 0.49) no grupo desafiado com TDCA 5mM em pH5, tendo sido significativamente maior que no grupo controle (0.96 ± 0.54) (Figura 21). Houve tendência de aumento da expressão do mRNM da E-caderina, Claudina-3 e ZO-1, mas sem significância estatística (Figuras 22, 23 e 24).

      Figura 20

    • – Expressão gênica relativa da ocludina Fonte: próprio autor.

      

    Expressão relativa do RNAm da ocludina na laringe submetida ao

    *

    desafio com solução de TDCA 5mM em pH5 comparada com a laringe

    exposta a solução de Krebs em pH7,4 (controle). P <0.05 (teste t não

    pareado). Os valores são expressos como média ± erro padrão da média.

    n= 3.

      Figura 21

    • – Expressão gênica relativa da claudina-1
    Figura 22

    • – Expressão gênica relativa da E-caderina Fonte: próprio autor.

      Expressão relativa do mRNA da E-caderina na laringe submetida ao desafio com solução de TDCA 5mM em pH5 comparada com a laringe exposta a solução de Krebs em pH7,4 (controle). p=0.13 (teste t não pareado). Os valores são expressos como média ± erro padrão da média. n=3.

      Figura 23

    • – Expressão gênica relativa de ZO-1 Fonte: próprio autor.

      Expressão relativa do mRNA da ZO-1 na laringe submetida ao desafio com solução de TDCA 5mM em pH5 comparada com a laringe exposta a solução de Krebs em pH7,4 (controle). p=0.13 (teste t não

      Expressão relativa do mRNA da Claudina-3 na laringe submetida ao desafio com solução de TDCA 5mM em pH5 comparada com a laringe exposta a solução de Krebs em pH7,4 (controle). p=0.09 (teste t não pareado). Os valores são expressos como média ± erro padrão da média. n=3.

      Figura 24

    • – Expressão gênica relativa da Claudina-3 Fonte: próprio autor.

    4.8 Expressão gênica das proteínas da via apoptótica

      O desafio da mucosa laríngea com solução de TDCA 5mM em pH fracamente ácido (pH5) durante 60 minutos levou a um aumento significativo da expressão do mRNA da proteína pró apoptótica Bax (Figura 25). Houve uma tendência de upregulation de Caspase-3, caspase executora, comum à via extrínseca e intrínseca, e tendência de downregulation da proteína anti apoptótica Bcl-2, ambas, no entando, sem significância estatística (Figuras 26 e 27).

      Figura 25

    • – Expressão gênica relativa de Bax Fonte: próprio autor.

      Expressão relativa do mRNA de Bax na laringe submetida ao desafio com solução de TDCA 5mM em pH5 comparada com a laringe exposta a solução de Krebs em pH7,4 (controle). p<0.05 (teste t não pareado). Os valores são expressos como média ± erro padrão da média. n=3.

      Figura 26

    • – Expressão gênica relativa de Caspase-3 Fonte: próprio autor.

      Expressão relativa do mRNA de Caspase-3 (casp3) na laringe submetida ao desafio com solução de TDCA 5mM em pH5 comparada com a laringe exposta a solução de Krebs em pH7,4 (controle). p=0.05 (teste t não pareado). Os valores são expressos como média ± erro Figura 27

    • – Expressão gênica relativa de BCl-2 Fonte: próprio autor.

      

    Expressão relativa do mRNA de Bcl-2 na laringe submetida ao desafio com

    solução de TDCA 5mM em pH5 comparada com a laringe exposta a solução

    de Krebs em pH7,4 (controle). p=0.16 (teste t não pareado). Os valores são

    expressos como média ± erro padrão da média. n=3.

    4.9 Efeito da Goma do Cajueiro na queda da RETE laríngea promovida pelo desafio com uma solução de TDCA 5mM em pH5

      A aplicação tópica da solução de goma do cajueiro (GC) por 5minutos previamente ao desafio com solução de TDCA 5mM em pH5 reduziu significativamente o percentual de queda na RETE laríngea (Figura 28). Após 60 minutos de desafio, houve queda de 50.71% (±3.07) na RETE no grupo em que houve a aplicação tópica de GC prévia ao desafio, enquanto no grupo sem aplicação da GC a queda foi de 63.63% (± 1.48) (Figura 29).

      Figura 28

    • – Efeito da Goma do Cajueiro na RETE da laringe exposta à solução de TDCA em pH5 por 60 minutos
    Ação na goma do cajueiro (GC) na prevenção da queda de RETE da laringe exposta à solução de TDCA 5mM em pH fracamente ácido (pH5) aos 60 minutos do desafio. *p<0.05 grupo GC + desafio (pH5 + TDCA 5mM) vs. Grupo desafio (controle) (Teste t não pareado). n=8.

      

    4.10 Efeito da Goma do Cajueiro no aumento da permeabilidade laríngea promovido

    pelo desafio com uma solução de TDCA 5mM em pH5

      Figura 29

    • – Efeito da Goma do Cajueiro na RETE da laringe exposta à solução de TDCA em pH5 aos 60 minutos do desafio Fonte: próprio autor.

      A aplicação tópica da solução de goma do cajueiro (GC) por 5minutos, previamente ao desafio com solução de TDCA 5mM em pH5, preveniu de forma significativa o aumento da permeabilidade transepitelial laríngea secundário ao desafio (Figura 30). Aos 90 minutos da presença da solução com fluoresceína, houve um aumento de 181 vezes na permeabiliadade transepitelial no grupo sem aplicação tópica da GC previamente ao desafio. Já no grupo em que foi feita a aplicação tópica da GC previamente ao desafio, houve aumento de 43 vezes na permeabilidade à fluoresceína após 90 minutos, valor este semelhante ao aumento de permeabilidade sem exposição ao desafio (pH 7) (Figura 30).

      Figura 30

    • – Efeito da Goma do Cajueiro no aumento de permeabilidade da laringe exposta à solução de TDCA em pH5 Fonte: próprio autor.

      Ação na goma do cajueiro (GC) na prevenção do aumento de permeabilidade da laringe exposta à solução de TDCA 5mM em pH fracamente ácido (pH5) por 60 minutos. Razão da intensidade de fluorescência aos 90 minutos (T90/T0). *p<0.05 grupo GC + desafio (pH5 + TDCA 5mM) e pH 7,4 vs. Grupo desafio (Kruskal Wallis e teste Dunn). n=5-10.

    5 DISCUSSÃO

      DRLF é comumente diagnosticada na prática otorrinolaringológica e está envolvida na etiologia de muitas doenças nas vias aéreas superiores, mas pouco se sabe sobre os efeitos do conteúdo gastroduodenal na laringe e há inúmeras controvérsias acerca do seu diagnóstico e tratamento.

      O presente estudo demonstrou que a exposição in vitro de laringe de camundongos a soluções que mimetizam o conteúdo do refluxo gástrico, incluindo o refluxo fracamente ácido, altera a barreira epitelial laríngea e que tal fenômeno pode ser prevenido pela aplicação tópica de goma de cajueiro.

      Estudos in vitro utilizando tecido laríngeo exposto a componentes que mimetizam o refluxo gástrico têm sido utilizados com sucesso no intuito de avaliar a susceptibilidade da mucosa laríngea à ação de tais agentes potencialmente lesivos (BULMER et al., 2010; ERICKSON; SIVASANKAR, 2010). Abordagens experimentais em animais são ferramentas úteis que tornam possíveis elucidar os eventos em humanos (GILL et al., 2005; KENNEDY et

      ., 2000; MONACO et al., 2015; TÉTREAULT, 2015). Experimentos adicionais com

      al

      laringes humanas são de extrema relevância, havendo de se considerar, no entanto, a dificuldade técnica de se proceder a biópsias de laringe, podendo ser um procedimento de risco, se feita em caráter ambulatorial.

      Primeiramente, foi verificado que mucosa laríngea de camundongo é cerca de cinco vezes menos resistente do que a esofágica, ao avaliar-se a RETE através da câmara de Ussing. A Mucosa esofágica de camundongo é formada por epitélio escamoso estratificado queratinizado, enquanto a mucosa laríngea de camundongo, no nível das pregas vocais, consiste em epitélio escamoso estratificado não queratinizado (MC INNES, 2014; SCUDAMORE, 2014), podendo ser este um dos mecanismos por trás da menor resistência epitelial da laringe nesta espécie. Em humanos não há essa diferença histológica, sendo os dois epitélios não queratinizados (TÉTREAULT, 2015). Ainda assim, se verifica uma maior anidrase carbônica III na laringe na presença de refluxo laringofaríngeo et al., 2006; GILL et al., 2005; JOHNSTON et al., 2004).

      Essa aparente fragilidade da barreira epithelial laríngea comparada à esofágica pode contribuir como embasamento teórico para explicar o fato de tantos casos clínicos de DRLF ocorrerem sem sintomas de DRGE (BULMER, et al., 2010).

      Por muito tempo, acreditou-se que a queda intensa no pH laríngeo provocada por contato com refluxo gástrico em baixo pH seria o principal responsável pelos sintomas do DRLF. No entanto, estudos recentes, utilizando combinação de impedanciometria multicanal e pHmetria, mostraram haver associação positiva entre sintomas de DRGE e DRLF com refluxo não ácido ou fracamente ácido (CAMPAGNOLO et al., 2014). O controle do refluxo ácido pelo uso de inibidores de bomba de prótons (IBP), apesar de mostrar-se efetivo para a cicatrização das lesões da esofagite por refluxo, mantém sintomáticos cerca de 40% dos pacientes com DRGE. Além disso, o uso do IBP, em regra, não é efetivo em controlar várias manifestações extra esofágicas do refluxo, como tosse e laringite (WETCHER et al., 1998), levantando a possibilidade de participação de outros agentes lesivos no refluxato.

      Partiu-se então para o estudo do efeito de soluções com diferentes pH, contendo os principais componentes considerados lesivos do suco gástrico, de forma isolada ou em conjunto, na mucosa laríngea de camundongos.

      Os experimentos revelaram que a exposição da mucosa laríngea a soluções contendo pepsina e TDCA em uma faixa de pH variando de 1 a 5 provocou uma queda na RETE dependente do pH, com o máximo efeito no pH 1. Tal efeito lesivo do ácido na mucosa laríngea está de acordo com os achados da literatura. Erickson e Sivasankar (2010), utilizando um modelo in vitro e metodologia semelhante para avaliar RETE, mostraram que soluções ácidas (pH 3), contendo ou não pepsina, alteram significativamente a integridade da mucosa laríngea suína. De forma semelhante, Sasaki et al. (2005), utilizando modelo animal com ratos, demonstrou altos escores inflamatórios na mucosa laríngea exposta ao ácido clorídrico (sem pepsina) em pH 1,5.

      Este dado experimental pode contribuir para a explicação do fato de que alguns pacientes em uso de IBP, os quais apresentam refluxato com pH entre 4 e 7, que é chamado pH fracamente ácido, ainda apresentarem sintomatologia e lesões no sistema digestivo e respiratório (FARRÉ et al., 2008; MERTENS et al., 2010).

      Baseado no exposto, optou-se por usar o pH 5 (fracamente ácido) como padrão das “soluções desafio” para testar os demais componentes do refluxato e o efeito na morfololgia epitelial, permeabilidade e expressão de proteínas de junção e proteínas da via apoptótica.

      Soluções fracamente ácidas, contendo pepsina 1mg/mL, pepsina 1mg/mL associada ao ácido taurodesoxicólico (TDCA) 2mM e TDCA 2mM isoladamente foram utilizadas para avaliar, in vitro, o efeito de cada componente do refluxato na RETE laríngea, sendo evidente que a quebra da barreira epitelial, determinada pela queda da RETE, ocorreu apenas quando o TDCA foi utilizado. O desafio com pepsina em meio fracamente ácido não alterou a resistência laríngea, levantando a possibilidade de o ácido biliar, e não a pepsina, ser o principal responsável pela lesão à mucosa laríngea em meio fracamente ácido.

      Os ácidos biliares podem atingir a via aérea superior através do refluxo duodenal para o estômago e esôfago. Estudos clínicos comprovam sua presença na saliva e secreção de orelha média, indicando que podem ser potenciais agentes lesivos na DRLF, inclusive em pH fracamente ácido e neutro (KLOKKENBURG et al., 2009; SASAKI et al., 2005; SEREG- BAHAR et al., 2015).

      Recentemente, vários estudos experimentais demonstraram o poder lesivo dos ácidos biliares na mucosa esofágica. Dois estudos in vitro utilizando esôfago de coelho demonstraram que a exposição da mucosa esofágica por 30 minutos a soluções com acidez e concentração de ácidos biliares semelhante a de pacientes em uso de IBP provoca queda de RETE (FARRÉ, 2008; PARDON, 2016). Utilizando análise morfológica em um modelo in vivo em rato, no qual ácidos biliares com diferentes pH foram aplicados por 10 minutos em dias alternados por 2 semanas na mucosa laríngea sadia, Sasaki et al. (2005) demonstraram com laringes de porcos e avaliando dano funcional epitelial através da RETE, mostraram ser necessário meio ácido para que a pepsina cause efeitos lesivos na mucosa, não havendo alterações funcionais quando a pepsina é usada em pH neutro. Corroborando esses resultados funcionais medidos por RETE, estudo de Bulmer et al. (2010) mostrou que a pepsina, em meio ácido, é capaz de provocar lesão em laringe de porcos in vitro, determinada não só por critérios histológicos como por dano celular medido por alterações na absorbância em comprimento de ondas específicos e liberação de DNA, não avaliando, no entanto, o efeito da pepsina em pH fracamente ácido ou neutro.

      Paradoxalmente, outros estudos experimentais apontam para a ausência de lesões de mucosa laríngea provocadas pela pepsina, mesmo em pH ácido. Trabalho de Durkes e Sivasankar (2015) mostra ausência de alterações epiteliais morfológicas e de expressão gênica de proteína de junção epitelial, de proteínas transportadoras de íons e de citocinas pró inflamatórias em resposta à exposição laríngea a uma solução com pH 3 e 4 associada à pepsina 1mg/mL em um modelo in vivo com laringe suína.

      Os achados do presente estudo, associado aos resultados da literatura descritos acima, reforçam a possibilidade de que a pepsina possa não ser agente agressor importante para a mucosa laríngea, cabendo aos ácidos biliares a função de componente lesivo em meio fracamente ácido.

      Ao avaliar se o tipo e concentração do ácido biliar influenciam funcionalmente a barreira epitelial, encontrou-se resultado semelhante utilizando-se o ácido taurodesoxicólico (TDCA) e o ácido desoxicólico (DCA). Ambos causaram queda significativa da RETE em concentrações de 2 e 5 mM, enquanto o ácido glicocólico (GCA) não promoveu alteração se comparado ao controle. Tal resultado funcional foi semelhante ao encontrado por Farré et al (2008) em mucosa esofágica de coelhos, quando foram testados os mesmos ácidos biliares nas mesmas concentrações. Neste estudo, no entanto, houve lesão mucosa no esôfago exposto ao GCA nas maiores concentrações.

      Estudos utilizando aspirados esofágicos de pacientes com DRGE mostram conjugados precisam de um pH ácido ou fracamente ácido para serem ativados, enquanto os componentes não conjugados causam dano mucoso preferencialmente em pH neutro (HARMON; JOHNSON; MAYDONOVITCH, 1981).

      Os resultados experimentais do presente estudo podem ser a base para uma interessante justificativa para a refratariedade dos sintomas e lesões laríngeas em parte dos pacientes em uso de IBP. Nesses casos, pode ser possível que as condições fracamente ácidas levem ao aumento da concentração de ácidos biliares não conjugados, como o DCA, os quais continuam a ser lesivos para a mucosa laríngea.

      A concentração de ácido biliar no estômago e esôfago é mensurável e estudos com aspirados gástricos e esofágicos em voluntários sadios e pacientes com DRGE mostram que o ácido biliar varia de indetectável em esôfago de voluntários sadios a cerca de 1mM em esôfago de pacientes com DRGE e tem concentração entre 0.3 e 2mM no aspirado gástrico de pessoas sadias, atingindo concentração de 10mM em estômago de pacientes com esofagite erosiva (FIORUCCI et al., 1995; GOTLEY et al., 1991; KAUER et al., 1997). Uma vez que o refluxato deixa o esôfago em direção à faringe e larínge, a detecção do ácido biliar torna-se muito difícil, em parte pela diluição pela secreção das vias respiratórias e saliva, sendo difícil, até o presente, mensurar a concentração de ácido biliar na laringe de pacientes com DRLF (PEARSON et al., 2011). As concentrações dos ácidos biliares utilizadas neste estudo, portanto, foram baseadas em trabalhos experimentais anteriores utilizando mucosa esofágica de coelhos e laríngea de ratos (FARRÉ et al., 2008; SASAKI et al., 2005).

      No presente estudo, a redução de RETE laríngea promovida pelo TDCA 5mM em meio fracamente ácido foi associada a alterações epiteliais laríngeas, visualizadas pela microscopia óptica. Em decorrência de um pequeno número de amostras adequadas para análise, foi realizado um estudo descritivo das alterações histológicas. Nas laringes expostas ao TDCA, foi notório o dano mucoso, evidenciado por descamação epitelial e edema de lâmina própria. Alterações estas ausentes nas laringes do grupo controle. Estudo de Sasaki et

      

    al. (2005), apesar de ter se baseado em critérios inflamatórios para definir as alterações

      Avaliou-se a expressão gênica das proteínas do complexo juncional na laringe exposta à solução fracamente ácida com TDCA em sua maior concentração (5mM), sendo detectado upregulation da expressão gênica de Claudina-1 e ocludina em resposta a 60 minutos de exposição ao desafio. Apesar de apenas essas duas proteínas terem apresentado diferença estatisticamente significativa, houve nítida tendência de upregulation da expressão gênica das demais proteínas juncionais avaliadas (e-caderina, ZO-1 e claudina-3). O pequeno “n” de cada grupo em que se avaliou a expressão gênica das proteínas foi o provável fator para a dificuldade estatística neste estudo. No princípio, havia 12 animais por grupo, mas, em decorrência da baixa quantificação de RNA de cada amostra (provavelmente devido ao tempo

      o

      que o tecido fica exposto ao desafio sob temperatura de 37

      C), foi necessário utilizar um pool de quatro animais por “n”, diminuído muito a quantidade de amostras. Inicialmente, tal resultado pareceu incongruente com a literatura que mostra diminuição das proteínas de junção associada com perda da barreira epitelial em pacientes com DRGE (GHATAK et al., 2016). Uma possível explicação para a aparente divergência do resultado seria a tentativa do epitélio de preservar suas propriedades de a adesão célula a célula em resposta ao dano no complexo juncional causado pelos 60 minutos de desafio, iniciando-se a sinalização da transcrição e subseqüente upregulation. Tal possibiliadade é apoiada por estudos em laringe exposta a estímulos vibratórios, e estudos em córnea, nos quais os autores hipotetizaram que a ruptura da membrana basal inicia upregulation de proteínas estruturais no intuito de preservar a integridade do epitélio (KENNEY et al., 1997; KOJIMA et al., 2014). Estudo em modelo esofágico utilizando solução ácida concluiu que a alteração no complexo juncional é o fator causal para o aumento na permeabilidade paracelular e consequente dilatação do espaço intercelular (TOBEY et al., 2008). Trabalho de Ghatak et al. (2016), utilizando cultura de células esofágicas humanas expostas a um coquetel de sais biliares em pH 5 e 7.4, analisou a morfologia das principais estruturas do complexo juncional, além da RETE. O estudo mostrou que as células expostas à solução com ácido biliar em meio fracamente ácido (pH 5) apresentam quebra da barreira epitelial, evidenciada promovido pelos componentes do refluxo, há escassos trabalhos na literatura que analisem o mecanismo de lesão laríngea promovido pelo DRLF. Tendo em vista seus resultados contraditórios, os poucos que existem não permitem que se chegue a uma definição de mecanismo. Reichel et al. (2008) e Gill et al. (2005) utilizando biópsia laríngea, descreveram diminuição da expressão de e-caderina em pacientes com DRLF. Já Durkes e Sivasankar (2015), através de modelo in vivo, não encontraram alteração na expressão gênica de e- caderina e ZO-1 em laringes suínas exposta a desafio com pepsina em meio ácido.

      Notou-se aumento significativo da permeabilidade mucosa à fluoresceína na laringe exposta ao desafio com solução fracamente ácida contendo TDCA 5mM por 60 minutos, achado este que vai ao encontro dos resultados de RETE e proteínas do complexo juncional, contribuindo para a quebra de barreira epitelial laríngea.

      A permeabilidade paracelular é de extrema importância para a defesa laríngea, uma vez que um aumento na permeabilidade transepitelial pode resultar em um acesso descontrolado de agentes lesivos a camadas mais profundas na mucosa, ativando

       2014 .

      RETE e permeabilidade paracelular são indicadores funcionais da barreira epitelial e alterações na RETE e permeabilidade tipicamente, mas não sempre, ocorrem em conjunto

       2014).

      Estudo utilizando biópsias de laringe humana mostrou alterações de mucosa como dilatação do espaço intercelular e redução da expressão de E-caderina em pacientes com DRLF (FRANCHI et al., 2007; GILL et al., 2005). Juntos, tais alterações podem indicar um aumento de permeabilidade mucosa em pacientes com DRLF, levando a um aumento de fluxo de pequenas moléculas através da mucosa laríngea. Não foi encontrado nenhum estudo experimental avaliando especificamente o efeito da bile na permeabilidade mucosa em laringe. Estudo in vitro, utilizando mucosa esofágica de coelhos, demonstra boa correlação entre redução de RETE, aumento de permeabilidade e aumento do espaço intercelular após exposição a solução fracamente ácida contendo ácidos biliares (FARRÉ et al., 2008).

      ácido, determinou-se a expressão gênica de proteínas da via apoptótica, tendo-se detectado da expressão gênica de Bax, proteína reguladora co características pró

      upregulation

      apoptóticas. Houve nítida tendência de upregulation da também pró apoptótica caspase-3 e

      

    downregulation da expressão gênica de Bcl-2, proteína da via mitocondrial com

      características anti apoptóticas. Apesar de ter havido diferença estatística significativa apenas com Bax (provavelmente pelo mesmo motivo do pequeno n de cada grupo, já descrito acima para expressão gênica das proteínas do complexo juncional), tal resultado indica que o TDCA 5mM em solução fracamente ácida induz apoptose das células do epitélio laríngeo, podendo ser este o mecanismo da quebra da barreira epitelial. Caspase-3 é a principal proteína executora, desempenhando papel essencial em ambas as vias apoptóticas (ZHANG et al., 2005a). Membros da família Bcl-2, componente da via mitocondrial da apoptose, são importantes reguladores da via apoptótica. Sendo uma proteína derivada de oncogene, Bcl-2 é um controle negativo na via de suicídio celular, enquanto o Bax promove a morte celular competindo com Bcl-2 (ZHANG et al., 2005a). Desta forma, a tendência de downregulation da expressão gênica da proteína Bcl-2 e o upregulation da expressão gênica de Bax, vistas neste estudo, sugerem que a apoptose induzida por ácido biliar na laringe de camundongos é relacionada à via mitocondrial da morte celular programada.

      A pesquisa de células apoptóticas na mucosa esofágica e laríngea de pacientes com doença do refluxo tem sido relativamente negligenciada. Encontrou-se, na literatura, apenas um estudo em humanos que mostra aumento da apoptose no epitélio esofágico na presença de esofagite e diminuição após a cirurgia anti refluxo (WETCHER et al., 1998). O agente do refluxato responsável pela indução de apoptose ainda é incerto. Estudos utilizando linhagem de células esofágicas cancerígenas (Eca109) (ZHANG et al., 2005a) e linhagens de células esofágicas normais (ZHANG et al., 2005b), demonstraram que ácidos biliares inibem o crescimento celular e induzem apoptose nas células in vitro. Verificaram, ainda, que a ativação da caspase-3, aumento na proteína Bax e diminuição da proteína Bcl-2 estão envolvidas na apoptose induzida por ácido biliar em células esofágicas cancerígenas (ZHANG encontrou trabalhos que avaliem apoptose laríngea decorrente da ação de componentes do refluxo.

      Optou-se por avaliar expressão gênica das proteínas do complexo juncional e da via apoptótica e permeabilidade à fluoresceína após 60 minutos de desafio, em vez dos 30 minutos da avaliação de resistência epitelial, baseado em trabalhos utilizando cultura de células esofágicas, que mostram início do processo apoptótico após 1 hora de exposição (McQUAID et al., 2011).

      Os resultados in vitro encontrados neste estudo, reforçando o papel dos ácidos biliares na ação lesiva do refluxato em pH fracamente ácido, abrem perspectiva para justificar a falta de resposta aos IBP que ocorre em cerca de metade dos pacientes com DRLF (PARK

      

    et al. , 2005). No meio fracamente ácido promovido por tais medicações, muito provavelmente

      a pepsina não exerceria seu potencial lesivo. Os ácidos biliares, no entanto, seriam responsáveis por manter as lesões e um percentual dos pacientes sintomáticos. Isso, por sua vez, incentiva o desenvolvimento de novas substâncias, capazes de conter esse efeito lesivo dos ácidos biliares na mucosa laríngea.

      No presente estudo, a GC na concentração de 10% e aplicada topicamente na mucosa laríngea do camundongo antes do desafio preveniu de forma significativa a queda na RETE e aumento da permeabilidade laríngea. Efeito este possivelmente decorrente das suas propriedades mucoadesivas na superfície da mucosa, como aventado nos estudos que avaliaram a GC na mucosa esofágica (DE LIMA et al., 2016).

      Há um crescente interesse em estudar substâncias com propriedades bioadesivas como opção terapêutica para o tratamento do DRGE. Soluções de alginato de sódio (usualmente em combinação com antiácido) são frequentemente usadas no tratamento da DRGE, havendo estudos mostrando sua capacidade de reduzir o número de episódios de refluxo ácido, com essa propriedade sendo considerada decorrente da tensão superficial da barreira viscosa do alginato (CASTELL et al., 1992; DETTMAR et al., 2007; ROHOF et al., 2013). Woodland et al. (2015) demonstraram efeito protetor de solução de alginato aplicada aumento da permeabilidade laríngea causadas pelo desafio com solução de TDCA 5mM em pH fracamente ácido.

      CG é um polímero natural, obtido da resina do caule da Anacardium occidentale, árvore conhecida como cajueiro, muito comum no nordeste do Brasil (DE PAULA; HEALTHY; BUDD, 1998). De lima et al descreveram efeito protetor in vitro da GC aplicada topicamente na mucosa esofágica exposta a solução ácida contendo pepsina e TDCA (DE LIMA et al., 2016). Tais autores explicaram que seu efeito decorre provavelmente de suas propriedades mucoadesivas fornecidas pelos seus polissacarídeos complexos. GC tem sido utilizada na indústria farmacêutica como agente gelificante, potenciador da viscosidade, sistemas de administração controlada e excipiente (KUMAR et al., 2012). Além de ser um biopolímero com características tão versáteis, algumas outras características levam a um interesse particular no seu uso. GC é uma substância atóxica, estável, de fácil disponibilidade, biodegradável e tem baixo custo (KUMAR et al., 2012). Estudos recentes em animais demostraram que a GC tem propriedades antiinflamatórias e protetoras do sistema gastrointestinal em parte associada a inibição do estresse oxidativo (CARVALHO et al., 2015; YAMASSAKI et al., 2015). Tais características farmacológicas são de grande utilidade no tratamento da DRLF, uma vez que essa condição é associada a inflamação e estresse oxidativo (SAMUELS; JOHNSTON, 2009).

      Baseado nos resultados expostos, pode-se sugerir um modelo hipotético no qual soluções fracamente ácidas, na presença de ácidos biliares, desencadeiam perda da barreira epitelial laríngea decorrente de alterações nas proteinas de junção epitelal, secundária à apoptose. Tais efeitos podem, teoricamente, ser prevenidos com o uso tópico da goma do cajueiro, provavelmente em decorrência de suas propriedades adesivas na mucosa laríngea (Figura 31).

      Ainda que se considerem necessários experimentos adicionais utilizando fragmentos de laringes humanas e experimentos utilizando modelo in vivo, os resultados apresentados podem encorajar novas pesquisas que ampliem o estudo dos efeitos protetores Figura 31

    • – Modelo hipotético de lesão laríngea pelo ácido biliar e efeito protetor da goma do cajueiro Fonte: próprio autor.

    6 CONCLUSÕES

       A queda na RETE laríngea é mais intensa quanto menor o pH, quando se utiliza solução contendo pepsina e ácido biliar, persistindo a queda, no entanto, mesmo com o pH 5.

       A quebra de barreira epitelial laríngea, verificada através da RETE, utilizando solução fracamente ácida, depende da presença de ácido biliar e não de pepsina.

       Os ácidos biliares TDCA e DCA têm comportamento semelhante na quebra da barreira epitelial laríngea, quando utilizados em meio fracamente ácido. Ambos diminuem a RETE nas concentrações de 2 e 5mM. O GCA não promoveu queda na RETE laríngea.  O desafio com ácido biliar numa solução com pH 5 na laringe aumentou a permeabilidade transepitelial e causou um upregulation na expressão gênica de proteínas do complexo juncional, associada a um aumento de expressão gênica de proteínas pró apoptoticas.  A GC, aplicada topicamente, possui efeito preventivo na quebra de barreira epitelial laríngea promovida pelo ácido biliar em meio fracamente ácido, verificado através de menor queda da RETE e menor aumento de permeabiliade transepitelial.

      

    REFERÊNCIAS

      ALTMAN, K. W. et al. Changing impact of gastroesophageal reflux in medical and otolaryngology practice. Laryngoscope, Hoboken, v. 115, p. 1145-1153, 2005. raz, v. 174. p. 299-307, 2015. BARBUTI, R. C. Gastroesophageal reflux disease: the role of Alginat. Gastroenterol.

      Endosc. Dig., São Paulo, v. 30, p. 49-51, 2011.

      BULMER, D. M. et al.

      Laryngoscope, Hoboken, v. 120, p. 777-782, 2010.

      ão Paulo, v. 18, p. 184-191, 2014. et al. Gastroprotective properties of cashew gum, a complex heteropolysaccharide of Anacardium occidentale, in naproxen-induced gastrointestinal damage in ran, v. 76, p. 143-151, 2015. CASTELL, D. O. et al. Alginic acid decreases postprandial upright gastroesophageal reflux. Comparison with equal-strength antacid. Dig. Dis. Sci., New York, v. 37, p. 589-593, 1992. CLARKE, P.; TYLER, K. LNature Rev. Microbiol., New York, v. 7, p. 144-155, 2009. CUNHA, P. L. R.; PAULA, R. C. M.; FEITOSA, J. P. A. Polysaccharides from brazilian biodiversity: an opportunity to change knowledge into economic value. Química Nova, São Paulo, v. 32, p. 649-660, 2009. , Ospedaletto, Pisa, v. 26, p. 241-246, Oct. 2006. DE LIMA, F. B. et al. Su1127 in vitro topical protection of human esophageal mucosal integrity by natural products from the Northeast Region of Brazil. Gastroenterology,

      Amsterdam , v. 150, p. S477, 2016.

      DETTMAR, P. W. et al. The suppression of gastro-oesophageal reflux by alginates. Int. J.

      Clin. Pract., Hoboken, v. 61, p. 1654-1662, 2007.

      DURKES, A.; SIVASANKAR, M. P. In vivo investigation of acidified pepsin exposure to porcine vocal fold epithelia. Laryngoscope, Hoboken, v. 126, p. E12-E16, 2015. ELMORE, S. Apoptosis: a review of programmed cell death. Toxicol. Pathol., Los Angeles, v. 35, p. 495-516, 2007. ERICKSON, E.; SIVASANKARryngoscope. Laryngoscope, Hoboken, v. 120, p. 1569-1575, 2010. FARRÉ, R. et al. Short exposure of oesophageal mucosa to bile acids, both in acidic and weakly acidic conditions, can impair mucosal integrity and provoke dilated intercellular spaces. Gut, London, v. 57, p. 1366-1374, 2008. FIORUCCI, S. et al. Circadian variations in gastric acid and pepsin secretion and intragastric bile acid in patients with reflux esophagitis and in healthy controls. Am. J. Gastroenterol., New York, v. 90, p. 270-276, 1995. FORMÁNEK, M. et al. Comparison of three methods used in the diagnosis of extraesophageal reflux in children with chronic otitis media with effusion. Gastroenterol.

      Res. Pract., London, v. 2015, p. 1-5, 2015.

      FRANCHI, A. et al. Dilatation of intercellular spaces is associated with laryngo-pharyngeal reflux: an ultrastructural morphometric analysis of laryngeal epithelium. Eur. Arch.

      Otorhinolaryngol., New York, v. 264, p. 907-911, 2007.

      GHATAK, S. et al. Bile salt at low pH cause dilatation of intercellular spaces in in vivo stratified primary esophageal cells, possibly by modutating Wnt signaling. J. Gastrointest.

      New York, v. 20, p. 500-509, 2016.

      Surg.,

      

      sand Oaks, v. 114, p. 913-921, 2005.

      GOTLEY, D. C. et al. Composition of gastro-oesophageal refluxate. Gut, London, v. 32, p. 1093-1099, 1991.

      JOHNSTON, N. et al. Pepsin and carbonic anhydrase isoenzyme III as disgnostic markers for laryngopharyngeal reflux disease. Laryngoscope, Hoboken, v. 114, p. 2129-2134, 2004. JOHNSTON, N. et al. Pepsin promotes proliferation of laryngeal and pharyngeal epithelial cells. Laryngoscope, Hoboken, v. 122, p. 1317-1325, 2012. JOHNSTON, N. et al. Receptor-mediated uptake of pepsin by laryngeal epithelial cells. Ann. v. 117, p. 1036-1039, 2007b.

      Otol. Rhinol. Laryngol., Thousand Oaks,

      KAUER, W. K. et al. Composition and concentration of bile acids reflux into the esophagus of patients with gastroesophageal reflux disease. Surgery, Bethesda, v. 122, p. 874-881, 1997. KENNEDY, R. J. et al. Interleukin 10-deficient colitis: new similarities to human inflammatory bowel disease. Br. J. Surg., Hoboken, v. 87, p. 1346-1351, 2000.

      KENNEY, M. C. et al. Abnormalities of the extracellular matrix in keratoconus corneas.

      Newtown Square, v. 16, p. 345-351, 1997.

      Cornea,

      KLOKKENBURG, J. J. C. et al. Bile acids identified in middle ear effusions of children with otitis media with effusion. Laryngoscope, Hoboken, v. 119, p. 396-400, 2009. KOJIMA, T. et al. Effects of phonation time and magnitude dose on vocal fold epithelial genes, barrier integrity and function. Laryngoscope, Hoboken, v. 124, p. 2770-2778, 2014. KOUFMAN, J. A. Laryngopharyngeal reflux is different from classic gastroesophageal reflux disease. Ear Nose Throat. J., Dallas, v. 81, p. 7-9, 2002. KUMAR, A. et al. Cashew gum a versatile hydrophylic polymer: a review. Current Drug Therapy, Beijing, v. 7, p. 2-12, 2012. MC INNES, E. The respiratory system. In: SCUDAMORE, C. L. (Ed.). Practical guide to the histology of the mouse. Chichester: Wiley & Sons, 2014. p. 179-189. MCQUAID, K. R. et al. Systematic review: the role of bile acids in the pathogenesis of

      MERTENS, V. et al. Gastric Juice from patients on acid suppressive therapy can still provoke a significant inflammatory reaction by human bronchial epithelial cells. J. Clin.

      Gastroenterol., Alphen aan den Rijn, v. 44, p. e230-e235, 2010.

      MONACO, G. et al. A comparison of human and mouse gene co-expression networks reveals conservation and divergence at the tissue, pathway and disease levels. BMC Evol. Biol., London, v. 15, p. 259, 2015. NEUNLIST, M. et al

      San Francisco, v. 310, p. G487-G496, 2016.

      PARK, W. et al. Laryngopharyngeal reflux:prospective cohort study evaluating optimal dose of proton-pump inhibitor therapy and pretherapy predictors of response. Laryngoscope, Hoboken, v. 115, p. 1230-1238, 2005. et al. Review article: reflux and its consequences

    • – the laryngeal, pulmonary and oesophageal manifestations. Conference held in conjunction with the 9th International Symposium on Human Pepsin (ISHP) Kingston-upon-Hull, UK, 21-23 April

      oken, v. 33, suppl. 1, p. 1-71, 2011.

      REICHEL, O. et al. E- cadherin but not β-catenin expression is decreased in laryngeal biopsies from patients with laryngopharyngeal reflux. Eur. Arch. Otorhinolaryngol., New York, v. 265, p. 937-942, 2008.

      RIBEIRO, A. J. et al.

      Gums’ based delivery systems: review on cashew gum and its derivatives. Carbohydr. Polym., Amsterdam, v. 147, p. 188-200, 2016. ROHOF, W. O. et al. An alginate-antacid formulation localizes to the acid pocket to reduce acid reflux in patients with gastroesophageal reflux disease. Clin. Gastroenterol. Hepatol., Amsterdam, v. 11, p. 1585-1591, 2013. SAMUELS, T. L.; JOHNSTON, N. Pepsin as a causal agent of inflammation during nonacidic reflux. Otolaryngol. Head Neck Surg., Thousand Oaks, v. 141, p. 559-563, 2009. SIFRIM, D. The role of salivary pepsin in the diagnosis of reflux. Gastroenterol. Hepatol., New York, v. 11, p. 417-419, 2015. SILVA, D. A.; FEITOSA, J. P. A.; PAULA, H. C. B.; DE PAULA, R. C. M. Synthesis and characterization of cashew gum/acrylic acid nanoparticles. Mat. Sci. Eng., Amsterdam, v. C29, p. 437-441, 2009. TÉTREAULT, M. P. Esophageal cancer: insights from mouse model. Cancer Growth Metastasis, Auckland, v. 8, suppl. 1, p. 37-46, 2015. THEISEN, J. et al. Suppression of gastric acid secretion in patients with gastroesophageal refluxdisease results in gastric bacterial overgrowth and deconjugation of bile acids. J.

      Gastrointest. Surg., New York, v. 4, p. 50-54, 2000.

      TOBEY, N. A. et al. Physicochemical basis for dilated intercellular spaces in non-erosive acid-damage rabbit oesophageal epithelium. Dis. Oesophagus, Hoboken, v. 21, p. 757-764, 2008.

      TOBEY, N. A. et al. Serosal bicarbonate protects against acid injury to rabbit esophagus.

      Amsterdam Gastroenterology, , v. 96, p. 1466-1477, 1989.

      WETCHER, G. J. et al. Reflux-indiced apoptosis of the esophageal mucosa is inhibited in Barrett´s epithelium. Am. J. Surg., New York, v. 176, p. 569-573, 1998. WOOD, J. M. et al. Biomarkers and laryngopharyngeal reflux. J. Laryngol. Otol., Cambridge, v. 125, p. 1218-1224, 2011. WOODLAND, P. et alAm. J.

      Physiol. Gastrointest. Liver Physiol., San Francisco, v. 308, p. G975-980, 2015.

      YAMASSAKI, F. T. et al. Effect of the native polysaccharide of cashew-nut tree gum exudate on murine peritoneal macrophage modulatory activities. Carbohydr. Polym., Amsterdam, v. 125, p. 241-248, 2015. ZHANG, R. et al. Bile salt inhibit growth and induces apoptosis of human esophageal cancer cell line. World J. Gastroenterol., Pleasanton, v. 11, p. 5109-5116, 2005a.

      ZHANG, R. et al. Bile salt inhibit growth and induces apoptosis of culture human normal esophageal mucosal epithelial cells. World J. Gastroenterol., Pleasanton, v. 11, p. 6466-

      ANEXO A Ố CERTIFICADO DE APROVAđấO COMITÊ DE ÉTICA

      ANEXO B Ố ARTIGO ENVIADO PARA PUBLICAđấO

    (American Journal of Physiology - Gastrointestinal and Liver Physiology)

    Title:In vitro assessment of mice laryngeal mucosal integrity and evaluation of topical

      protective effect of a natural polymer

      Running Head: Laryngeal mucosal integrity and topical protective treatment 1,2 2,3 2,3

      

    Authors: Aline A Figueiredo , Ana Paula M Santana , Lucas AD Nicolau , Francisco J

      3

      3

      3

      2 Batista-Lima ,Deysi VT Wong , Larisse T Lucetti , Gabriela LP Batista , Natália A

      2

    3 2,4

      5 Caminha , Armênio A Santos , Pedro Marcos Gomes Soares , Daniel Sifrim , Marcellus 1,2

      HLP Souza 1 2

    Department of Surgery, Federal University of Ceará, Fortaleza, Brazil; LEFFAG

      

    Laboratory of Physiopharmacology Study of Gastrointestinal Tract, Department of

    3 Physiology and Pharmacology, Federal University of Ceará, Fortaleza, Ceará, Brazil;

    Department of Physiology and Pharmacology, Federal University of Ceará, Fortaleza,

    4 5 Brazil; Department of Morphology, Federal University of Ceará, Fortaleza, Brazil; Barts

    and the London School of Medicine and Dentistry, Queen Mary University of London,

    London, UK;

      Author Contributions:

      Souza M H L P, Sifrim D, Santos A A:conception and design of the research; Figueiredo A A, Santana A P M, Nicolau L A D, Batista-Lima F J, Wong D V T, Batista G L P, Caminha N A:performed the experiments; Figueiredo A A, Nicolau L A D, Soares P M G: analyzed the data; Santos A A, Souza M H L P, Sifrim D:interpreted the results of the experiments; Figueiredo A A, Santana A P M, Nicolau L A D, Lucetti L T:prepared the figures; Figueiredo A A, Santana A P M, Nicolau L A D, Caminha N A, Lucetti L T:drafted the

      manuscript;

      Figueiredo A A, Souza M H L P:edited and revised the manuscript; Souza M H L P, Sifrim D:approved the final version of the manuscript.

      ABSTRACT:

      In vitro exposure of laryngeal mucosa to acidic solutions can produce mucosal changes similar to those observed in human laryngitis. Cashew gum is a natural polymer obtained from a Brazilian northeastern tree (Anacardium occidentale L.), which has a topical protective effect on human esophageal mucosa. We evaluated the in vitro effect of solutions simulating human gastric juice and the subsequent topical protective effect of cashew gum on mice laryngeal mucosa. Murine (Swiss) laryngeal samples were mounted in Ussing chambers. The luminal side of biopsies was exposed to solutions of different acidity with or without pepsin and/ortaurodeoxycholic acid (TDC). Transepithelial electrical resistance (TER) was continuously recorded. The topical protective effect of cashew gum solution was evaluated by pre-coating the biopsies before the exposure to a solution at pH 5 containing 5mM TDC.

      Changes in TER and mucosal permeability to fluorescein were measured.Exposure of laryngeal mucosa to acidic solutionscontainingpepsinandTDC provoked a pH-dependent drop in TER with the maximal effect at pH 1, but still present at pH 5 (weakly acidic). The exposure of the laryngeal mucosa to a solution of pH 5 with TDC, but not with pepsin, produced a dose-dependent decrease in TER. Pre-coating the mucosa with cashew gum prevented the reduction of TER and increased trans-epithelial permeability by exposure to a solution at pH5containingTDC.In conclusion,weakly acidic solutions containing bile acids can produce impairment of laryngeal epithelial barrier,which may be protected by topical treatment with cashew gum.

      

    NEW AND NOTEWORTHY: In this study, we evaluatedthe in vitro effect of different

      solutions simulating human gastric juice on mice laryngeal mucosa. We demonstrated that weakly acidic solutions containingbile acids could impair the laryngeal barrier. There have been no studies on the effect of a topical protective solution in laryngeal mucosa.Our findings reveal that a natural polymer (cashew gum) has a topical protective effect on murine laryngeal mucosal integrity in vitro.These findings have provided new perspectives for the treatment of reflux laryngitis.

      Introduction

      Laryngopharyngeal reflux (LPR) is an extra-esophageal manifestation of gastroesophageal reflux disease (GERD) in which gastric refluxate directly contacts the laryngeal epithelium (11). It is worth notingthat repetitive gastro-esophago-laryngeal reflux can produce macro or microscopic damage to the laryngeal mucosa and ENT symptoms such as throat cleaning, coughing, and hoarseness(8,7,2).

      Studies in human laryngeal biopsies revealed molecular and cellular repercussions of LPR, such as decreased laryngeal mucin (pre-epithelial endogenous wall), dilated paracellular spaces (DIS), and decreased expression of E-cadherin, which is an important molecule involved in the epithelial barrier of mucosal larynx (26, 17, 7, 8). Taken together, these changes can impair the barrier function that prevents noxious components of the refluxate from infiltrating the laryngeal mucosa, thereby culminating in symptoms such as cough and odynophagia due to the sensitization of nociceptors. Similarly,in vitro exposure of laryngeal mucosa to acidic solutions can impair the mucosal barrier. This has been demonstrated functionally through the measure of transepithelial electrical resistance (TER).Using healthy porcine larynges in an in vitro model, Erickson and Sivasankar demonstrated that acidic pepsin challenge significantly reduced TER and suggested that this could reflect reflux-related epithelial disruption (5).

    • – Gastric contents can reach the esophagus and upper airway at a weakly acidic pH (4

      7) and this condition is often found in patients taking proton pump inhibitors (15). Studies show that, at this weakly acidic pH, solutions containing bile acids can damage the

      Recently, it has been demonstrated that the esophageal mucosa can be topically protected from the damage produced by the components of gastroesophageal refluxate and that this effect seems to be due to adherence of alginate to the mucosal surface (27, 28).

      Cashew gum, a natural polymer obtained from the resin of a Brazilian northeastern tree (AnacardiumoccidentaleL.), is a biomacromolecule with adhesive properties. It has beendemonstrated that cashew gum exhibits anti-inflammatory and gastro-protective properties in animal models(3, 29). Experiments in our lab showed that pre-coating human esophageal biopsies withcashew gum solution confers protection against acidic solution containing pepsin and bile acids as it reducesTER (4).

      To the best of our knowledge, there are no studies regarding the effect of any topical protectant solution against the damage caused by refluxate components to the laryngeal mucosa. This study aimedto evaluate the effect of in vitro exposure of mice laryngeal mucosa to solutions that simulated human gastric juice and to assess thetopical protective effect of cashew gum on mice laryngeal mucosal integrity in vitro.

      Material and methods Animals

      Male Swiss mice (30

    • –40 g) were obtained from the Department of Surgery of the Federal University of Ceará. The animals were housed in cages in a temperature-controlled environment under a 12 h light/12 h dark cycle and received food and water ad libitum. All surgical proceduresin this study were performed in accordance with the Guide for Care and Laboratory Animal Uses, established by the Brazilian College of Animal Experimentation (COBEA). The animal use protocol was approved by the Animal ResearchEthics Committee of the Federal University ofCeará (protocol: 23/2016).

      Surgical procedure

      The animals were deeply anesthetized with an intraperitoneal injection of ketamine (100mg/kg) and xylazine (10mg/kg), and euthanized by exsanguination. The larynx of each animal was removed, dissected, and opened along the dorsal sagittal plane. Proximal and distal fragments of the esophagus were also removed and opened when necessary, for studying esophageal basal resistance. During dissection, all tissues were kept moist in Krebs solution, pH7.4 (NaCl: 118 mM; KCl: 4.7 mM; MgSO

      4 : 1.2 mM; CaCl 2 :1.2 mM; NaH

      2 PO 4 : 1.2 mM; NaHCO : 25 mM; dextrose: 11.1 mM).

    3 Baseline Transepithelial Resistance (TER)

      Laryngeal fragments were mounted in an adapted Ussing chamber (Mussler Scientific Instruments, Aachen, Germany) containing Krebs solution (pH 7.4), with the anterior commissureplaced precisely in the adaptor’s orifice, to record the baseline TER. The deflections induced by bipolar current pulses of 50µA, during 200ms every 6s, applied through platinum wires. All experiments were conducted under open-circuit conditions.

      Evaluation of laryngeal TER using different challenges

      After registering baseline values, the solution in the luminal chamber was replaced with a “challenge solution,” as follows: 1) Krebs solution at pH 1 with 1mg/mL pepsin and 2mM taurodeoxycholic acid (TDC); 2) Krebs solution at pH 2 with 1mg/mL pepsin and 2mM TDC; 3) Krebs solution at pH 5 with 1mg/mL pepsin and 2mM TDC; 4) Krebs solution at pH 5; 5) Krebs solution at pH 5 with 1mg/mL pepsin; 6) Krebs solution at pH 5 with 2mM TDC; 7) Krebs solution at pH 5 with 0.5mM TDC; 8) Krebs solution at pH 5 with 5mM TDC; 9) Krebs solution at pH 5 with5mM deoxycholic acid(DC); 10) Krebs solution at pH 5 with 5mM glycocholic acid (GC); and 11) Krebs solution at pH 7. Over the course of 30 minutes, TER was continuously measured and the percentage change in TER at 1, 5, 10, 20, and 30 minutes was calculated.

      Transepithelial permeability

      To assess larynx transepithelial permeability, TER was recorded for 30 minutes according to the methodology described for the measurement of TER. Subsequently, the biopsies were kept mounted in the same chamber, which functioned as a diffusion chamber (Mussler Scientific Instruments) for measurements of permeability to fluorescein (332 Da).

      The solution at the luminal side was replaced by 1 mg/mL fluorescein solution. A sample of 100

      L was removed from the non-luminal side of the chamber at 0, 15, 30, 45, 60, 75, and 90 minutes. The same amount of solution was removed from the mucosal side at each time

      

    Effect of cashew gum on weakly acidic solution containing TDC-induced laryngeal

    damage

      To analyze the effect of cashew gum on TER and laryngeal transepithelial permeability, the tissue was mounted in anUssing chamber in the same manner as described previously.After stabilization of the basal resistance, the recording was paused and the chambers were removed, and separated for side exposure of the larynx. An aliquot of 200

      μL of the protective solution (10% cashew gum) or Krebs solution (control) was applied to the exposed luminal side and left in contact with the mucosa for five minutes. The mucosal side chamber was then filled with 3.5 mLKreb’s solutionat pH 5 with 5mM TDC for the recording of TER for 60 minutes after a new stabilization period. After 60 minutes of challenge, the same method described above was performed for the evaluation of transepithelial permeability.

      Statistical analysis

      Values are expressed as the mean ± standard error of the mean (S.E.M.). In resistance experiments, comparisons between groups were analysed by one-way ANOVA followed by Tukey’s test, when significant. In the analysis of fluorescein permeability between test and control group, Mann-Whitney test was used. When comparing the cashew gum protected group with the non-protected and control groups (pH 7.4), one-way ANOVA and Tukey's multiple comparison tests or Kruskal-

      Wallis and Dunn’s test were used when appropriate. Differences were considered to be significant when p< 0.05.

      Results Transepithelial resistance Baseline TER in larynx and esophagus

      Esophageal (proximal [PE] and distal [DE]) and laryngeal (L) baseline transepithelial resistances (TER) were compared (Figure 1). Baseline TER was significantly lower in the

      2

      laryngeal mucosa (34.8 ± 2.78 ) than in the esophageal mucosa (DE= 174.3 ± 43.08 Ω/cm

      2

      2 ; PE= 152.2 ± 33.01 ).

      Ω/cm Ω/cm

      Laryngeal TER varying with pH

      The effect of the solution with pepsin (1mg/mL) and TDC (2mM) on laryngeal mucosa was analyzed for different pH values (Figure 2A). TER decreased significantly after exposure to the test solutions at pH1, pH2, and pH5 when compared to the control solution (Krebs at pH7.4; P<0.05), with the maximal effect at pH 1, but still decreases at pH 5 (weakly acidic). The greatest reduction in TER was observed after 30 minutes when the average TER declined to 70.7% of the baselineat pH1, 52.3% at pH2, and 32.8% at pH5 (Figure 2).

      Effect of pepsin and bile acids in a weakly acidic solution

      Compared to the control solution, when pepsin-only challenge was used, there was no difference in TER (P<0.05). Conversely, TER decreased significantly when the larynx was exposed to a weakly acidic solution with bile acid and pepsin or bile acid-only (drop of 33±2.2% and 33±3.4%, respectively. P<0.05) as compared to TER of the control solution.

      The reduction in TER with bile acid-only challenge did not differ from bile acid with pepsin

      49.59% ± 3.49). The unconjugated DC used at 5mM reduced the laryngeal TER in similar to that of TDC (drop of 44.87% ±5.48). Conversely, 5mM GC did not alter laryngeal TER (Figure 4).

      

    Effect of pH 5 solution containing TDC (5mM) on fluorescein permeability in laryngeal

    mucosa.

      Over the course of 90 minutes, there was a progressive increase in transepithelial permeability when the challenge was performed with the 5mM TDC solution at pH 5. This permeability was significantly different at 90 minutes (Figure 5A), when the ratio of fluorescence intensity immediately after exchange of solution was 181.6 ± 46.53), compared to a ratio of 23.18 ± 10.47) with Krebs solution at pH 7.4 (control) (Figure 5B).

      

    Effect of pre-coating with 10% cashew gum solution on laryngeal mucosa exposed to

    weakly acidicTDC solution (pH 5).

      The topical application of cashew gum solution for 5 minutes prior to challenge with 5mM TDC solution at pH 5 significantly reduced the percentage of decrease in laryngeal TER (Table1). After 60 minutes of challenge, there was a drop of 50.71± 3.07%) in TER in the group that received pre-coating with cashew gum, while, in the group without cashew gum application,therewas a verified decrease of 63.63 ± 1.48%. The cashew gum also prevented the increase of transepithelial permeability to fluorescein, induced by exposure to a solution of pH5with TDC 5mM (Table 1). After the mucosa was placed in the fluorescein solution for 90 minutes, there was a 181-fold increase in transepithelial permeability in the group without GC topical application prior to challenge. In the group where the topical application of GC

      Figures and Tables Figure 1 Figure 2 Figure 3

      Figure 4 Figure 5

      

    Table 1.Effect of pre-coating with 10% cashew gum solutionon laryngeal mucosal

    exposed to weakly acidic solution containing TDC (pH 5).

      Permeability to TER (% of basal fluorescein resistance at 30 min)

      90 (Ratio T /T )

      97.03

      23.18  2.08  10.47

      Kreb’s solution, pH 7.4

      (n=6) (n=5) 36.37 181.6

       1.48*  46.53*

      Kreb’s solution, pH5 + 5mM TDC

      (n=8) (n=10)

      # #

      49.29  3.07 43.33  12.76

      Cashew gum 10%

      (n=8) (n=6)

    • p<0.05 vs.pH7.4; #p<0.05 vs.pH5 + 5mMTDC (one- way ANOVA and Turkey’s multiple comparison test / Kruskall- Wallis and Dunn’s test).

      Discussion

      Laryngopharyngeal reflux disease is commonly diagnosed in ENT practice, and is implicated in the etiology of many laryngeal disorders. Despite this, little is known about the effects of gastro duodenal contents on the laryngeal mucosa and there are numerous controversies surrounding its diagnosis and treatment.

      The present study demonstrated that laryngeal exposure to solutions that mimic gastric refluxate contents, including weakly acidic reflux, can impair the epithelial barrier and that this phenomenon can be prevented by the topical application of cashew gum.First, we verified that crude basal values of laryngeal mucosal TER were around five times lower than the esophageal mucosal TER in mice. Mouse esophageal mucosa is a keratinized stratified squamous epithelium while mouse laryngeal mucosa, at the level of the vocal folds, consists of non-keratinized stratified squamous epithelium (14, 22). This may be one of the mechanisms of lower laryngeal epithelial resistance in mice. Therefore, this apparent fragility of the functional laryngeal epithelial barrier compared to the esophagus could at least, in partexplain the observation that many cases of LPR occur without classic symptoms of GERD (1). It is necessary to consider, however, the difference between murine and human esophageal epithelia, with the former being keratinized stratified squamous epithelium, and the latter not being keratinized (24). Even considering those histological differences, experimental approaches in animals are useful tools that make it possible to elucidate events in humans (24, 8, 9, 16). Experiments with human laryngeal biopsy are useful, but may be technically limited because of the risk of damaging healthy airways during the procedure. pH3,regardless of the presence of pepsin,significantly impaired porcine laryngeal mucosal integrity (5). Similarly, Sasaki demonstrated a high inflammation score in rat larynges exposed to hydrochloric acid without pepsin at pH 1.5 (21).

      Notably, we observeda decrease in TER at pH 5 in a solution containing pepsin and TDC. Farré et al., using rabbit esophageal mucosa in vitro, showed that incubation of the tissue with weakly acidic solutions containing bile acids also decreased TER (6).

      Despite the majority of reflux events in patients who are taking proton pump inhibitors with GERD being acidic in nature, the refluxate pH vary between 4 to 7, which is usually called weakly acidic in clinical practice (15). This persistent exposure to gastric contents in a weakly acidic milieu is likely responsible for laryngeal and esophageal refractory symptoms in some patients with LPR and GERD who do not respond to traditional antireflux therapy with proton pump inhibitors.

      In order to define the main component of the refluxate involved in the decrease of TER,using weakly acidic solution containing pepsin and TDC, we separately studied each component and demonstrated the importance of bile acid as the main harmful component of the refluxate. In weakly acidic solutions, our results showed that only pepsin, as a component of the “refluxate-mimic,” was not able to cause a decrease in laryngeal TER. Conversely, in the presence of bile acid (TDC), we observed a decrease in laryngeal TER in a concentration dependent manner, thereby demonstrating that bile acid can be topically injurious to laryngeal mucosa. Two experimental studies usingrabbit esophagus exposed to weakly acid bile acid solutions, similar to patients undergoingproton pump inhibitors therapy, caused a reduction inflammation score in those exposed to a weakly acidic 5mM TDC, thereby corroborating that damage is pH dependent (21).

      Pepsin is an acidic protease that has maximum activity at pH between 1.9 and 3.6 (19). Erickson et al., using porcine larynxes, showed that an acidic environment is necessary for pepsin to compromise the laryngeal epithelial barrier, and there are no tissue changes when pepsin is used at a neutral pH (pH 7) (5). Despite there being a lack of an effect of pepsin in a weakly acidic milieu, it is still possiblethat pepsin can be used as a reflux marker sinceit indicates reflux in the respiratory tract despite it not causing laryngeal damage (10, 23).

      When evaluating whether the type and concentration of bile acid functionally influences the epithelial barrier, a similar result was found using TDC and deoxycholic acid (DC). Both caused a significant decrease in TERfollowing exposure to concentrations of 2 and 5 mM, whereas glycocholic acid (GC) did not promote a change when compared to the control. Studies using esophageal aspirates of patients with GERD show an increase in certain bile acids, includingTDC andGC, in those who were taking proton pump inhibitors and an increase in unconjugated bile acids, such as DC, in those who were not using medication. This increase in unconjugated bile acid in patients undergoingproton pump inhibitors therapy is possibly a result of gastric bacterial overgrowth due to the weakly acidic environment and subsequent deconjugation of bile acids (25). Our experimental results may provide an interesting hypothesis for refractory laryngitis in a subgroup of patients using proton pump inhibitors. In these cases, it could be possible that weakly acidic conditions lead to an increase in unconjugated bile acid, such as DC, which may continue to damage the laryngeal mucosa. permeability typically, but not always, occurs in unison (13). For this reason, we studied the effect of a solution containing 5mM TDC at pH5 in laryngeal epithelial permeability to fluorescein, which indicates a clear correlation between the decrease of TER and the increase in permeability. Studies using laryngeal biopsies show mucosal changes, such as dilated paracellular spaces and a reduction in E-cadherin expression, in patients with LPR (8,7). Together, these changes might indicate an increase in mucosal permeability in patients with LPR due to susceptibility related to a flux of small molecules through the laryngeal mucosa.

      We did not find any experimental studies evaluating the effect of bile acid on laryngeal mucosal permeability. An in vitro study using rabbit esophageal mucosa showed a great correlation between TER reduction, increased permeability and dilated intercellular spaces after exposure to a weakly acidic solution containing bile acids (6). Therefore, permeability to fluorescein could be a valuable marker of a reduction in the laryngeal epithelial barrier. Accordingly, there is great clinical potential of substances that can prevent this loss of the epithelial barrier and the subsequent increase in permeability caused by the contact of bile acid with the laryngeal mucosa.

      There is a growing interest in studying substances with bioadhesive properties as a therapeutic option for the treatment of GERD. Woodland et al. demonstrated a protective effect of an alginate solution applied topically to the esophageal mucosa prior to challenge with acidic solution containing TDC, thereby emphasizing that this action derives from its adhesive properties on the mucosa, and could work as a topical treatment for GERD (28). In this study, we tried to use alginate as a possible laryngeal protector, before exposure to 5mM gumprevented a reduction in TER and an increase in transepithelial permeability in the laryngeal mucosa exposed to TDC in a weakly acidic solution. De Lima et al. described the in vitro protective effect of cashew gum applied topically in esophageal mucosa exposed to acidic solution containing pepsin and TDC (4). These researchers further explained that this effect is likely due to its muco-adhesiveness properties, which are provided by complex polysaccharides. Cashew gum has been used frequently in thepharmaceutical industry as a gelling agent, viscosity enhancer, controlled delivery system, and an excipient (12). Besides being a versatile biopolymer, some characteristics have been of particular interest in its use.

      GC is a non-toxic, stable, easily available, biodegradable, and inexpensive substance (12).Recent studies have demonstrated that theanti-inflammatory properties and gastrointestinal protective activity of cashew gum is in part associated withthe inhibition of oxidative stress (3, 29). Such pharmacological features may be useful in LPR therapy, since this condition is associated with inflammatory and oxidative stress (20). Although additional experiments using human larynxes and in vivo models are necessary, these results may indicate a novel approach to LPR treatment.

      In conclusion, this in vitro study demonstrated that laryngeal mucosa exposed to solutions that mimic human gastric juice could produce functional changes in the epithelial barrier. The impairment of the laryngeal mucosa barrier produced by weakly acidic solutions containing bile acidscould be protected by topical treatment with 10% cashew gum. These findings have provided new perspectives for the treatment of LPR.

      Grants

      References 1.

      Bulmer DM, Ali MS, Brownlee IA, Dettmar PW, Pearson JP

      aryngoscope 120(4): 777 –782, 2010.

      2. Medeiros T, Assunção

      AR.Laryngopharyngeal reflux: diagnosis, treatment, and latest researc : 184 –191, 2014.

      3. Nicolau LA, Sousa FB, Damasceno SR, Silva DA, Barbosa AL, Leite JR, Medeiros JV. Gastroprotective properties of cashew

      gum, a complex heteropolysaccharide of Anacardium occidentale, in naproxen- induced gastrointestinal damage in ra:143

    • –151, 2015.

      4. De Lima FB, Nicolau L, Woodland P, Lee C, Santana APM, Silva D, Leite JR,

      Melo I, Souza MAN, Santos AA, Souza MH, Sifrim D. Su1127 in vitro topical

      protection of human esophageal mucosal integrity by natural products from the northeast region of Brazil. Gastroenterology 150: S477, 2016.

      5. Erickson E, Sivasankar, M. Laryngoscope 120(8): 1569 –1575, 2010.

      6. Farré R, van Malenstein H, De Vos R, Geboes K, Vanden Berghe P, Fonari F,

      Blondeau K, Mertens V, Tack J, Sifrim D. Short exposure of oesophageal mucosa

      to bile acids, both in acidic and weakly acidic conditions, can impair mucosal integrity and provoke dilated intercellular spaces. Gut 57:1366

    • –1374, 2008.

      7. Franchi A, Brogelli B, Massi D, Santucci M, De Campora E, Gallo O.Dilatation of

      8. Pignatelli M, Pearson J, Dettmar PW, Koufman J.

      Laryngeal epithelial defenses against laryngopharyngeal reflux: investigations of E- cadherin, carbonic anhydrase isoenzyme III, and pepsin. 2): 913

       –921, 2005.

      9. Kennedy RJ, Hoper M, Deodhar K, Erwin PJ, Kirk SJ, Gardiner KR. Interleukin

      10-deficient colitis: new similarities to human inflammatory bowel disease. Br J Surg 87(10): 1346 –1351, 2000.

      10. Klokkenburg JJC, Hoeve HLJ, Francke J, Wieringa MH, Borgstein J, Feenstra

      L. Bile acids identified in middle ear effusions of children with otitis media with

      effusion. Laryngoscope 119(2): 396 –400, 2009.

      11. Koufman JA. Laryngopharyngeal reflux is different from classic gastroesophagealreflux disease. Ear Nose Throat J 81(9: 7

    • –9, 2002.

      12. Kumar A, Moin A, Shruthi R, Ahmed A, Shivakumar HG.Cashew Gum A Versatile Hydrophylic Polymer: A Review. Current Drug Therapy 7: 2 –12, 2012.

       . and Injury A Research Review 2014

      14. Mc Innes E. The respiratory system. In: Practical guide to the histology of the mouse, edited by Cheryl L. Scudamore. Chichester, UK: Wiley & Sons, Ltd, 2014, p. 179- 189.

      15. Mertens V, Blondeau K, Vanaudenaerde B, Vos R, Farre R, Pauwels A, Verleden

    G, Van Raemdonck D, Dupont L, Sifrim D. Gastric Juice from patients on acid

      and divergence at the tissue, pathway and disease levels. BMC Evol Biol 15: 259, 2015.

      17. Niv Y, Fass R. The role of mucin in GERD and its complications. Nat Rev 9(1): 55

      Gastroenterol Hepatol –9, 2011.

       Vanuystsel T, Ceulemans LJ, Vieth M, Jimenez

      

      M, Tack J, Farré R. A weakly acidic solution containing deoxycholic acid induces

      esophageal epithelial apoptosis and impairs integrity in an in vivo perfusion rabbit 0: G487

    • –G496, 2016.

      Johnston N, Allen J, Tinling SP, Johnston N,

      Belafsky P, Arevalo P, Sharma N, Castell DO, Fox M, Harding SM, Morice AH, Watson MG, Shields MD, Bateman N, McCallion WA, van Wijk MP, Wenzl TG, Karkos PD, Belafsky PC. Review article: reflux and its consequences--

      the laryngeal, pulmonary and oesophageal manifestations. Conference held in conjunction with the 9th International Symposium on Human Pepsin (ISHP) Kingston-upon-Hull, UK, 21

    • –23 April 3 (Suppl.1):

      1 –71, 2011.

      20. Samuels TL, Johnston N. Pepsin as a causal agent of inflammation during nonacidic reflux. Otolaryngol Head and Neck Surg 141: 559

    • –563, 2009.

      ): 192

    • –7, 2005.

      22. Scudamore CL. Gastrointestinal system. In: Practical guide to the histology of the

      23. Sereg-Bahar M, Jerin A, Jansa R, Stabuc B, Hocevar-Boltezar. Pepsin and bile acidis in saliva in patients with laryngopharyngeal reflux

    • – a prospective comparative study. Clin Otolaryngol 40: 234 –239, 2015.

      24. Tétreault, Marie-Pier. Esophageal Cancer: Insights From Mouse Model. Cancer

      Growth Metastasis 8(Suppl 1): 37 –46, 2015.

      25. Theisen J, Nehra D, Citron D, Johansson J, Hagen JA, Crookes PF, DeMeester

      SR, Bremner CG, DeMeester TR, Peters JH. Suppression of gastric acid secretion

      in patients with gastroesophageal refluxdisease results in gastric bacterial overgrowth and deconjugation of bile acids. J Gastrointest Surg 4: 50

    • –54, 2000.

      26. Wood JM, Hussey DJ, Woods CM, Watson DI, Carney AS.Biomarkers and

      laryngopharyngeal reflux. J Laryngol Otol 125: 1218 –1224, 2011.

      27. Woodland P, Lee C, Duraisamy Y,Farré R, Dettmar P, Sifrim D. Assessment and protection of esophageal mucosal intefrity in patients with heartburn without esophagitis. Am J Gastroenterol 108: 535 –543, 2013.

      28. Woodland P, Batista-Lima F, Lee C, Preston SL, Dettmar P, Sifrim D J Physiol Gastrointest Liver 15; 308(12): G975 Physiol –80, 2015.

      29. Yamassaki F T, LenzI R M, Campestrini L H, Bovo F, Seyfried M, Soldera-Silva A, Stevan-Hancke FR, Zawadski-Baggio SF, Pettolino FA, Bacic A, Maurer JB.

      Effect of the native polysaccharide of cashew-nut tree gum exudate on murine peritoneal macrophage modulatory activities. Carbohydrate Polymers 125: 241

    • –248,

      Legends Figure 1

      Distal esophagus (DE), proximal esophagus (PE) and laryngeal (L) baseline transepithelial resistance (TER; n=5

    • –7). *p<0.05 vs. DE and PE (one-way ANOVA and Tukey's multiple comparison test).

      Figure 2

      Effect of solutions with different pH containing pepsin (1 mg/mL) and taurodeoxycholic acid (TDC) (2mM) on laryngeal TER (n=5

    • –7). *p<0.05 vs.pH 7.4 (one-way ANOVA and Tukey's multiple comparison test).

      Figure 3

      Effect of pH 5 solutions containing pepsin (1mg/mL) and/or TDC (2mM) on laryngeal TER after 30min of exposure (n=5

    • –7). *p<0.05 vs.pH 7.4 (one-way ANOVA and Tukey's multiple comparison test).

      Figure 4

      Effect of pH 5 solutions containing different concentrations of TDC (0.5, 2 and 5mM), DC (5mM), and GC(5mM) on laryngeal TER after 30 minutes of exposure (n=5

    • –7). *p<0.05 vs. pH 7.4 (one-way ANOVA and Tukey's multiple comparison test).

Novo documento

Tags

Documento similar

PERFIL PROFISSIONAL DO BIBLIOTECÁRIO EM AMBIENTES DE INFORMAÇÃOAUDIOVISUAL
0
0
19
UNIVERSIDADE FEDERAL DO CEARÁ FACULDADE DE ECONOMIA, ADMINISTRAÇÃO, ATUÁRIA, CONTABILIDADE E SECRETARIADO EXECUTIVO – FEAACS DEPARTAMENTO DE ADMINISTRAÇÃO CURSO DE ADMINISTRAÇÃO SUZE ANNE SOMBRA SANTOS
0
0
40
UNIVERSIDADE FEDERAL DO CEARÁ FACULDADE DE ECONOMIA, ADMINISTRAÇÃO, ATUÁRIA, CONTABILIDADE E SECRETARIADO EXECUTIVO CURSO DE CIÊNCIAS ECONÔMICAS ARLAN JUSTINO DIAS
0
0
65
UNIVERSIDADE FEDERAL DO CEARÁ FACULDADE DE DIREITO DEPARTAMENTO DE DIREITO PROCESSUAL CLAUDENILTON DE QUEIROZ SOUSA
0
0
66
O PERFIL DO PROFISSIONAL DE SECRETARIADO EXECUTIVO NO CONTEXTO DA ATUAL GESTÃO DE PESSOAS
0
0
78
O PERFIL DO PROFISSIONAL DE SECRETARIADO EXECUTIVO NO CONTEXTO ATUAL
0
0
67
UNIVERSIDADE FEDERAL DO CEARÁ CENTRO DE CIÊNCIAS AGRÁRIAS DEPARTAMENTO DE TECNOLOGIA DE ALIMENTOS CURSO DE MESTRADO EM CIÊNCIA E TECNOLOGIA DE ALIMENTOS ÁFIA SUELY SANTOS DA SILVA DE ALMEIDA
0
0
70
PERFIL DE SAÚDE BUCAL DO PACIENTE PORTADOR DE FISSURA LABIOPALATINA: ESTUDO EPIDEMIOLÓGICO EM HOSPITAL PEDIÁTRICO DO NORDESTE BRASILEIRO
0
0
35
UNIVERSIDADE FEDERAL DO CEARÁ FACULDADE DE ECONOMIA, ADMINISTRAÇÃO, ATUÁRIA, CONTABILIDADE E SECRETARIADO DEPARTAMENTO DE CONTABILIDADE CURSO DE CIÊNCIAS CONTÁBEIS ARIÁDINE MARIA MUNIZ SOMBRA
0
0
20
UNIVERSIDADE FEDERAL DO CEARÁ FACULDADE DE ECONOMIA, ADMINISTRAÇÃO, ATUÁRIA, CONTABILIDADE E SECRETARIADO CURSO DE CIÊNCIAS ECONÔMICAS PERFIL DA ATIVIDADE TURÍSTICA
0
0
53
CLINICAL AND EPIDEMIOLOGICAL PROFILE AND ADHESSION TO THE TREATMENT OF ELDERLY HYPERTENSION PERFIL CLÍNICO-EPIDEMIOLÓGICO Y ADHESIÓN AL TRATAMIENTO DE ANCIANOS CON HIPERTENSIÓN
0
0
7
UNIVERSIDADE FEDERAL DO CEARÁ FACULDADE DE MEDICINA DEPARTAMENTO DE FISIOLOGIA E FARMACOLOGIA PROGRAMA DE PÓS-GRADUAÇÃO EM FARMACOLOGIA MESTRADO PROFISSIONAL FRANCISCO EVANIR GONÇALVES DE LIMA
0
0
76
PERFIL ANTROPOMÉTRICO E DA APTIDÃO FÍSICA DE UMA ATLETA DE ARTES MARCIAIS MISTAS: UM ESTUDO DE CASO COM UMA ATLETA DE ELITE
0
0
51
A PERDA DE UMA CHANCE COMO UM DANO INDENIZÁVEL E A FORMA DE QUANTIFICAÇÃO DESSE PREJUÍZO PERANTE OS TRIBUNAIS BRASILEIROS
0
0
82
UNIVERSIDADE FEDERAL DO CEARÁ CENTRO DE CIÊNCIAS AGRÁRIAS DEPARTAMENTO DE CIÊNCIAS DO SOLO PROGRAMA DE PÓS-GRADUAÇÃO EM CIÊNCIA DO SOLO ISABEL CRISTINA DA SILVA ARAÚJO
0
0
155
Show more