PONTIFÍCIA UNIVERSIDADE CATÓLICA DE GOIÁS PRÓ-REITORIA DE PÓS-GRADUAÇÃO E PESQUISA PROGRAMA DE PÓS-GRADUAÇÃO MESTRADO EM GENÉTICA ASSOCIAÇÃO DO POLIMORFISMO G894T DO GENE eNOS COM GLAUCOMA PRIMÁRIO DE ÂNGULO ABERTO

Livre

0
0
59
6 months ago
Preview
Full text

  

PONTIFÍCIA UNIVERSIDADE CATÓLICA DE GOIÁS

PRố-REITORIA DE PốS-GRADUAđấO E PESQUISA

PROGRAMA DE PốS-GRADUAđấO MESTRADO EM

GENÉTICA

  

ASSOCIAđấO DO POLIMORFISMO G894T DO GENE eNOS

COM GLAUCOMA PRIMÁRIO DE ÂNGULO ABERTO

Goiânia – GO

  

2017

  EDUARDO EUSTÁQUIO DE ALMEIDA FILHO ASSOCIAđấO DO POLIMORFISMO G894T DO GENE eNOS COM GLAUCOMA PRIMÁRIO DE ÂNGULO ABERTO

  Dissertação apresentada ao Programa de Pós-Graduação Mestrado em Genética - MGene, Pontifícia Universidade Católica de Goiás

  • – PUC Goiás, como parte das exigências para a obtenção do título de Mestre em Genética. Orientadora: Profª. Drª. Kátia Karina Verolli de O. Moura

  Goiânia – GO 2017 A447a Almeida Filho, Eduardo Eustáquio de Associação do polimorfismo G894T do gene eNOS com glaucoma primário de ângulo aberto[ manuscrito]/ Eduardo Eustáquio de Almeida Filho.-- 2017. 57 f.; 30 cm Dissertação (mestrado) - Pontifícia Universidade Católica de Goiás, Programa de Pós-Graduação Stricto Sensu em Genética , Goiânia, 201 7 Inclui referências f.44-51

  1. Glaucoma. 2. Polimorfismo (Genética). I.Moura, Katia Karina Verolli de Oliveira. II.Pontifícia Universidade Católica de Goiás. III. Título.

CDU: 617.7-007.681(043)

  Dedico este trabalho...

  Аоs meus pais, irmãos, minha esposa Ana Laura e meus filhos que, com muito carinho е apoio, não mediram esforços para que еu chegasse até esta etapa de minha vida.

  Agradecimentos

  À professora Katia Karina Verolli de Oliveira, pela paciência na orientação е incentivo que tornaram possível а conclusão deste trabalho.

  À Deus, meus pais e minha família

  SUMÁRIO

LISTA DE FIGURAS..........................................................................................................VIII

LISTA DE TABELAS..............................................................................................................X

LISTA DE APÊNDICES.......................................................................................................XII

SIGLAS, SÍMBOLOS E ABREVIATURAS.....................................................................XIII

RESUMO...............................................................................................................................XV

ABSTRACT..........................................................................................................................XVI

  

1. INTRODUđấO...................................................................................................................15

  

1.1 Definição de glaucoma.......................................................................................................15

  

1.2 Classificação de glaucoma.................................................................................................16

  

1.3 Fisiopatologia do glaucoma...............................................................................................17

  

1.4 Fatores genéticos e o glaucoma.........................................................................................18

1.5 Óxido nítrico sintetase (NOS)...........................................................................................19

  

1.5.1 Formação e função do óxido nítrico...............................................................................20

  

1.5.2 Isoformas de NOS...........................................................................................................22

  

1.5.3 Polimorfismo da eNOS (G894T) ...................................................................................25

  

2. OBJETIVOS........................................................................................................................26

  

2.1 OBJETIVOS GERAIS......................................................................................................26

  

2.2 OBJETIVOS ESPECÍFICOS...........................................................................................26

  

3. MATERIAIS E MÉTODOS...............................................................................................27

  

3.1 Casuística...........................................................................................................................27

  

3.2 Coleta, extração e quantificação do DNA genômico........................................................27

  3.3 Reação em Cadeia da Polimerase – PCR..........................................................................28

  

3.4 Análise de Dados................................................................................................................30

  

4. RESULTADOS....................................................................................................................32

  

5. DISCUSSÃO........................................................................................................................38

  

6. CONCLUSÃO.....................................................................................................................43

  

7. REFERÊNCIAS BIBLIOGRÁFICAS..............................................................................44

APÊNDICE I............................................................................................................................52

APÊNDICE II .........................................................................................................................55

  LISTAS DE FIGURAS

Figura 1. Esquema anatômico do globo ocular e fluxo do humor aquoso.................................15

Figura 2: Esquema da ação do óxido nítrico nos vasos sanguíneos. Nas células endoteliais a

  ativação do receptor presente na membrana plasmática leva a um influxo de cálcio. O aumento de cálcio ativa a eNOS, a qual é responsável pela produção de oxido nítrico tendo como substrato a L-arginina. O óxido nítrico se difunde através do músculo liso e ativa a enzima guanilato ciclase (GC), a qual é responsável pela produção do segundo mensageiro chamado de GMP cíclico (cGMP), levando a relaxamento do músculo liso através da diminuição do cálcio intracelular................................................................................................................................21

  

Figura 3: Mecanismo de ação da óxido nítrico sintetase neuronal (nNOS) que pode ser

  encontrado em neurônios pré-sinápticos e pós-sinápticos. Esquerda: em alguns neurônios pré- sinápticos não adrenérgicos não colinérgicos o potencial de ação leva a influxo de cálcio com ativação da nNOS e produção de oxido nítrico. O oxido nítrico ativa a guanilato ciclase (GC) nas células musculares lisas dos vasos sanguíneos após difusão e assim leva a aumento do GMP cíclico e consequente vasodilatação. Direita: Ativação do receptor NMDA (N-metil-d- aspartato) pós-sináptico pelo glutamato leva a aumento do cálcio intracelular e ativação da nNOS a produzir óxido nítrico...................................................................................................22

Figura 4: Mecanismo de ação da óxido nítrico sintetase induzida (iNOS) em macrófagos.

Citocinas leva a transcrição de RNA mensageiro devido ativação do gene da iNOS no núcleo. Com a formação de iNOS ocorre a produção de grande quantidade de óxido nítrico que interage com ânion superóxido formando o peróxido nitrito e radicais hidróxidos que são muito tóxicos e assim podem ser usados para matar bactérias fagocitadas.......................................................23

  

Figura 5: Localização das diferentes isoformas de NOS na retina............................................24

Figura.6: Figura esquemática do gene que codifica a eNOS. O gene humano da eNOS contem

  26 éxons de 21 kilobases localizado no 7q35-36. Os exons estão descritos pelos números. Polimorfismos específicos no genes da eNOS estão assinalados pelas setas...........................................................................................................................................25

  

Figura 7. Gel de agarose a 2%, corado com brometo de etídeo, indicando a presença ou

  ausência do alelo selvagem do polimorfismo G894T do gene eNOS. O ladder confirma que os fragmentos amplificados s ão constituídos por 181pb. As colunas de 1 a 4 mostram a amplificação da banda...............................................................................................................30

  

Figura 8. Gel de agarose a 2%, corado com brometo de etídeo, indicando a presença ou

  ausência do alelo polimórfico (T) do polimorfismo G894T do gene eNOS. O ladder confirma

  que os fragmentos amplificados são constituídos por 171 pb. As colunas de 15, 19, 20 e 21 mostram a amplificação da banda..............................................................................................30

  LISTA DE TABELAS

Tabela 1: Genes e lócus associados ao glaucoma......................................................................18

Tabela 2: Isoformasde NOS......................................................................................................22

Tabela 3: Primer usado para genotipagem do polimorfismo da sintetase óxido nítrico endotelial

  (NOS3) .....................................................................................................................................28

  

Tabela 4: Protocolo do polimorfismo G894T para alelo selvagem.........................................28

Tabela 5: Protocolo do polimorfismo G894T para alelo mutante...........................................29

Tabela 6: Protocolo de termociclagem para amplificação dos primers do polimorfismo

  G894T do gene eNOS para técnica de PCR.............................................................................29

  

Tabela 7: Características demográficas dos pacientes casos e controles ................................. 32

Tabela 8: Distribuição genotípica do Polimorfismo do gene eNOS (G894T) nos grupos caso e

  controle..................................................................................................................................... 32

  

Tabela 9: Distribuição gênica dos alelos G e T do gene eNOS (G894T) nos grupos caso e

  controle......................................................................................................................................33

  

Tabela 10: Distribuição genotípica do polimorfismo do gene eNOS (G894T) nos grupos caso

  e controle em pacientes do sexo masculino................................................................................33

  

Tabela 11: Distribuição genotípica do polimorfismo do gene eNOS (G894T) nos grupos caso e

  controle em pacientes do sexo feminino....................................................................................33

  

Tabela 12: Distribuição gênica dos alelos G e T do gene eNOS (G894T) nos grupos caso e

  controle em pacientes do sexo masculino..................................................................................34

  

Tabela 13: Distribuição gênica dos alelos G e T do gene eNOS (G894T) nos grupos caso e

  controle em pacientes do sexo feminino....................................................................................34

  

Tabela 14: Distribuição genotípica do Polimorfismo do gene eNOS (G894T) nos grupos caso

  e controle em pacientes com diabetes........................................................................................34

  

Tabela 15: Distribuição gênica dos alelos G e T do gene eNOS (G894T) nos grupos caso e

  controle em pacientes do diabetes..............................................................................................35

  

Tabela 16: Distribuição genotípica do Polimorfismo do gene eNOS (G894T) nos grupos caso

  e controle em pacientes com hipertensão arterial sistêmica.......................................................35

  

Tabela 17: Distribuição gênica dos alelos G e T do gene eNOS (G894T) nos grupos caso e

  controle em pacientes com hipertensão arterial sistêmica..........................................................35

  

Tabela 18: Distribuição genotípica do Polimorfismo do gene eNOS (G894T) nos grupos caso

  e controle em pacientes brancos.................................................................................................36

  

Tabela 19: Distribuição genotípica do Polimorfismo do gene eNOS (G894T) nos grupos caso

  e controle em pacientes negros..................................................................................................36

  

Tabela 20: Distribuição genotípica do Polimorfismo do gene eNOS (G894T) nos grupos caso

  e controle em pacientes pardos..................................................................................................37

  

Tabela 21: Associação do polimorfismo G894T da eNOS e o desenvolvimento de

  doenças......................................................................................................................................41

  LISTA DE APÊNDICE

APÊNDICE I: Termo de consentimento livre e esclarecimento para os pacientes com

  glaucoma...................................................................................................................................52

  

APÊNDICE II: Termo de consentimento livre e esclarecido-grupo controle ..........................55

  SIGLAS, SIMBOLOS E ABREVIATURAS

  GPAA - Glaucoma primário de ângulo aberto GPAE - Glaucoma primário de ângulo estreito GJAA - Glaucoma juvenil de ângulo aberto GPN - Glaucoma de pressão normal GCP - Glaucoma congênito primário GS - Glaucoma secundário GAA - Glaucoma de ângulo aberto GPE - Glaucoma pseudoexfoliativo DM - Diabetes mellitus HAS - Hipertensão arterial sistêmica PIO - Pressão intraocular OMS - Organização Mundial de Saúde MYOC - Miocilina OPTN - Optineurina TNFα - Fator de necrose tumoral alfa WDR36 - WD repeat domain 36 Kb - Kilobases mL - Mililitros mmHg - Milímetro de mercúrio % - Por cento Mg/mL - Miligramas por mililitro PCR - Reação em Cadeia da Polimerase Pb - Pares de bases μg/mL - Microgramas por mililitro

  VDS - Sistemas de vídeo documentação X2 - Qui-quadrado OR - Odds Ratio

  IC - Intervalo de confiança P - Probabilidade

   - Menor ou igual que > - Maior que

  SNP - Polimorfismo de nucleotídeo único

  PITX2 - Pituitária homeobox2 LOXL1 - Lisil oxidase like 1 PEX - Pseudoesfoliação PEXG - Glaucoma pseudoesfoliativo NTF4 - Neurotrofina-4 (TGF)-

  • fator de crescimento latente transformador (LTBP) - família ligadoras de proteínas NOS - Sintetase óxido nítrico NOS I - NOS neuronal nNOS - NOS neuronal NOS II - NOS induzida iNOS - NOS induzida NOS III - NOS endotelial

  eNOS - NOS endotelial G - guanina T - timina

  RESUMO

  Glaucoma pode ser definido como uma degeneração progressiva da camada de fibras nervosas da retina que resulta na morte das células ganglionares, eventualmente causando cegueira. É a primeira causa de cegueira irreversível no mundo. A fisiopatologia do glaucoma não é totalmente elucidada, embora se tenha conhecimento de vários fatores de risco como alterações genéticas, raciais, idades e aumento da pressão intraocular. Este estudo trata-se de um caso- controle onde foram analisadas 116 amostras sendo 32 pacientes com glaucoma primário de ângulo aberto (18 homens e 14 mulheres; variação de idade 65-89 anos) e 84 controles (44 masculinos e 40 femininos; variação de idade 65-86 anos). As amostras foram submetidas à extração de DNA, em seguida à PCR e analisadas em gel de agarose a 2%, corados com brometo de etídio a 5 g/mL. Na investigação do polimorfismo G894T do gene eNOS foi encontrado no grupo caso 0% (0/32) de homozigotos para o alelo selvagem (GG), 93,75% (30/32) de heterozigotos (GT) e 6,25% (2/32) homozigotos para o alelo polimórfico (TT). No grupo controle foi encontrado 9,52% (8/84) de homozigotos para o alelo selvagem (GG), 82,14% (69/84) de heterozigotos (GT) e 8,33% (7/84) de homozigotos para o alelo polimórfico (TT). Não houve diferença estatística significante. Quanto a frequência alélica do gene eNOS (G894T) no grupo caso foi encontrado 46,8% do alelo selvagem (G) e 53,2% do alelo T, já no grupo controle a frequência do alelo G foi de 50,5% e 49,5% do alelo T. Não houve diferença estatística significante. Da mesma forma não houve relação estatisticamente significativa do

  

polimorfismo com hipertensão arterial, gênero, diabetes e etinia. São muitas as possíveis

  interações desses polimorfismos e o desenvolvimento de glaucoma, mas ainda são necessários mais estudos para uma maior elucidação destas associações.

  Palavras-chave: Glaucoma. Polimorfismo. G894T. eNOS

  ABSTRACT

Glaucoma can be defined as a progressive degeneration of the retinal nerve fiber layer that

results in death of the ganglion cells, eventually causing blindness. It is the first cause of

irreversible blindness in the world. The pathophysiology of glaucoma is not fully elucidated,

although several risk factors such as genetic, racial, age and increased intraocular pressure are

known. This study was a case-control study in which 116 samples were analyzed: 32 patients

with primary open-angle glaucoma (18 males and 14 females; age range 65-89 years) and 84

controls (44 males and 40 females; Aged 65-86 years). The samples were submitted to DNA

extraction, then to PCR and analyzed on 2% agarose gel, stained with 5 g / mL ethidium

bromide. The G894T polymorphism of the eNOS gene was found in the 0% (0/32) group of

homozygotes for the wild-type (GG) allele, 93.75 % (30/32) of heterozygotes (GT) and 6.25%

(2/32) homozygous for the polymorphic (TT) allele. In the control group, 9.52% (8/84) of

homozygotes for the wild-type (GG), 82.14% (69/84) heterozygotes (GT) and 8.33% (7/84)

homozygotes for the polymorphic allele (TT). There was no statistically significant difference.

As for the allelic frequency of the eNOS gene (G894T) in the case group, 46.8% of the (G)

allele and 53,2% of the T allele were found, whereas the G allele frequency was 50.5% and 49,

5% of the T allele. There was no statistically significant difference. Likewise, there was no

statistically significant relationship between the polymorphism with hypertension, gender,

diabetes and ethnicity. There are many possible interactions of these polymorphisms and the

development of glaucoma, but further studies are needed to further elucidate these associations.

  Keywords: Glaucoma. Polymorphism. G894T (rsl1799983). eNOS

1. INTRODUđấO

1.1 Definição de glaucoma

  Estima-se que 79,6 milhões de pessoas estarão afetadas por glaucoma no ano de 2020, 10% das quais serão bilateralmente cegas. Glaucoma pode ser definido como uma degeneração progressiva da camada de fibras nervosas da retina que resulta na morte das células ganglionares, eventualmente causando cegueira. É a primeira causa de cegueira irreversível no mundo (QUIGLEY, 2006a). A fisiopatologia do glaucoma não é totalmente elucidada, embora se tenha conhecimento de vários fatores de risco como alterações genéticas, raciais, idades e aumento da pressão intraocular (PIO) (HOWELL et al., 2013).

  O fluxo uveoescleral é responsável por 5 a 15% da regulação da PIO, ele drena o humor aquoso através dos espaços intramusculares do corpo ciliar e permite a sua saída pelo espaço supraciliar (FAUTSCH et al., 2006). A maior drenagem do humor aquoso é realizada por uma estrutura chamada de malha trabeculada e pelo canal de Schlemm. Ele é produzido no corpo ciliar, liberado na câmara posterior e segue em direção da pupila até a câmara anterior alcançando assim a malha trabecular. A malha trabecular pode contrair ou relaxar para mediar o fluxo do humor aquoso através do canal de Schlelem, regulando desta forma a pressão intraocular (DOUCETTE et al., 2015a) (Fig.1).

  Figura 01. Esquema anatômico do globo ocular e fluxo do humor aquoso. Fonte: Biblioteca virtual em saúde 2008.

  Como a PIO é o maior fator de risco envolvido na etiologia do glaucoma, a maioria dos tratamentos consiste em diminuir a PIO para impedir o início e progressão do glaucoma via medicações ou intervenções cirúrgicas. Medicações inclui análogos de prostaglandina e betabloqueadores, ou opções cirúrgicas como a trabeculéctomia, inserção de shunt para drenagem do humor aquoso ou colocação de tubo. Intervenção precoce é importante já que o dano glaucomatoso é irreversível e quando já iniciado o dano ao nervo óptico este se torna suscetível a danos adicionais mesmo com diminuição da PIO (CAPRIOLI; COLEMAN, 2008).

1.2 Classificação do glaucoma

  O glaucoma pode ser classificado como: primário, congênito, juvenil ou glaucoma secundário. Glaucoma primário ocorre sem características sindrômicas, enquanto o glaucoma secundário resulta de defeitos da câmara anterior que contribui com risco de 50% de chance de desenvolver glaucoma. Estes defeitos incluem adesões cerato-lenticulares como é visto na anomalia de Peters ou hipoplasia de íris como é visto na síndrome de Axenfeld-Rieger (ITO; WALTER, 2014).

  Os subtipos de glaucoma pode ser dividido de forma adicional pela idade em que o indivíduo inicia a doença: glaucoma congênito ocorre nos primeiros 2 anos após o nascimento, e glaucoma juvenil desenvolve antes dos 40 anos. Estes subtipos podem ser classificados dependendo da anatomia do ângulo iridocorneano da câmara anterior, o qual regula a fluxo do humor aquoso. São chamados de glaucoma de ângulo aberto e glaucoma de ângulo fechado. Glaucoma de ângulo aberto, comumente visto em pacientes descendentes de africanos, tem ângulo da câmara anterior normal, embora o fluxo do humor aquoso é restringido por malformação no mecanismo de fluxo convencional. Glaucoma de ângulo fechado, comumente visto em populações do leste asiático, é o fechamento deste ângulo que impede o fluxo do humor aquoso (DOUCETTE et al., 2015a).

  Juntos, estes subtipos são usados para descrever o glaucoma como glaucoma primário de ângulo aberto, glaucoma primário de ângulo fechado, e glaucoma de ângulo aberto juvenil. Glaucoma primário de ângulo aberto é um condição crônica responsável por quase três quartos de todos os glaucomas nos Estados Unidos (THAM et al., 2014)(QUIGLEY, 2006b) e é considerado como a principal causa de cegueira irreversível no mundo.

1.3 Fisiopatologia do glaucoma

  A patogenia do glaucoma primário de ângulo aberto não é totalmente conhecida, mas suspeita-se de que uma interferência na drenagem do humor aquoso cause degeneração progressiva das camadas de células ganglionares da retina devido aumento da pressão intraocular. Glaucoma agudo de ângulo fechado ocorre em aproximadamente 10% dos pacientes e é considerado uma condição aguda onde o ângulo iridocorneano se torna fechado (DOUCETTE et al., 2015b).

  Estudos populacionais tem mostrado que o aumento da idade é o maior fator de risco para glaucoma (RUDNICKA et al., 2006), embora numerosos estudos não mostram qualquer aumento considerável da PIO com o envelhecimento (DEOVER; EYE, 1992)(WONG et al., 2009)(NOMURA et al., 1999)(ROCHTCHINA; MITCHELL; WANG, 2002)(WEIH et al., 2001). O glaucoma de pressão normal é frequente em pacientes mais idosos e não é tipicamente visto em crianças ou adolescentes (CHUMBLEY; BRUBAKER, 1976)(LEVENE, 1980).

  Glaucoma é considerado uma doença neurodegenerativa pois ocorre morte das células ganglionares da retina, perda de axônios e danos da micróglia, classificando neuropatia óptica glaucomatosa entre outras doenças neurodegenerativas como o Parkinson e Alzheimer (JINDAL, 2013). Como em outras doenças neurodegenerativas, glaucoma primário de ângulo aberto pode ser dividido em formas de início precoce e formas de início tardio, ambas sendo resultados da interação de fatores genéticos e ambientais (HERNANDEZ, 2000)(MCKINNON, 2012).

  Estudos recentes com pacientes apresentando Alzheimer mostraram ocorrência de glaucoma de 25,9% e de 5,2% em controles, com diferença estatisticamente significativa, e sugere que as células ganglionares da retina de pacientes com Alzheimer são menos resistentes ao aumento da pressão intraocular (BAYER; FERRARI, 2002)(WOSTYN; AUDENAERT; DE DEYN, 2009). Um estudo no Japão encontrou resultados semelhantes com 23,8% dos pacientes com Alzheimer apresentando glaucoma primário de ângulo aberto e apenas 9,9% nos pacientes controles (TAMURA et al., 2006). Blanks et al, 1996 sugerem que a morte neuronal das camadas de células ganglionares pode ser incluída entre as outras manifestações do Alzheimer a qual inclui morte progressiva do córtex cerebral e neurite dos astrócitos e micróglia na região do hipocampo, resultando em perda da memória recente (JINDAL, 2013).

  Vários fatores ambientais são considerados como atuantes dentro do mecanismo central da fisiopatologia do glaucoma, causando aumento da pressão intraocular e contribuindo para morte das células ganglionares da retina (WIGGS, 2012).

  Tabagismo tem sido investigado desde 1970 como fator relacionado ao glaucoma, porém com resultados ainda conflitantes (CHIOTOROIU et al., 2013).

1.4 Fatores genéticos e o glaucoma

  Glaucoma pode originar-se de fatores hereditários ou não-hereditários (RAYMOND, 1997). Formas hereditárias de glaucoma resultam de estímulos de fatores ambientais, interação fatores ambientais com fatores genéticos, e/ou interação epistática. Glaucoma também pode originar-se de herança mendeliana como visto em pacientes com mutações na miocilina (RESCH; FAUTSCH, 2009). Um sumário de genes associados ao glaucoma pode ser encontrado na tabela 1.

  Tabela 1: Genes e lócus associado ao glaucoma.

  GENE NOME LOCALIZAđấO TIPO DE GLAUCOMA MYOC Miocilina 1q23 GJAA, GPAA CYP1B1 Citocromo P450 familia 1, subtipo B, polipeptídio 1

  2p21 GPAA, GPN WDR36 WD domínio de repetição 36 5q22 GPAA OPTN Optineurina 10p14-p15 GPN LMX1B LIM fator 1 beta de transcrição homeobox

  9q34.1 GAA FOXC1 Forkhead box proteína C1 6p25 GCP PITX2 Pituitaria homeobox 2, 4q25 GCP LOXL1 Lisil oxidase like1 15q22 GPE NTF4 Neurotrofina-4, 19q13.33 GPAA LTBP2 Proteina de ligação beta do fator de crescimento latente 2

  14p24.2-24.3 GCP, GS ASB10 Anquirina de repetição e SOCS

  Box contendo 10 7q35-q36 GPAA Fonte: adaptada de (DOUCETTE et al., 2015a).

  Vários estudos tem mostrado que as características quantitativas altamente transmitidas no glaucoma são pressão intraocular, espessura central da córnea e a relação escavação/disco (DIMASI; BURDON; CRAIG, 2010)(GARWAY-HEATH et al., 1998)(VAN KOOLWIJK et al., 2012)(CHANG et al., 2005)(KLEIN; KLEIN; LEE, 2004)(TOH et al., 2005)(VAN KOOLWIJK et al., 2007). Tem sido demonstrado que a medida da pressão intraocular em pacientes com anormalidades da córnea é afetada por diferenças na espessura da córnea e doenças da superfície ocular (ARGUS, 1995)(SHAH et al., 1999)(WHITACRE; STEIN; HASSANEIN, 1993). Grande número de genes e influências ambientais controlam as características quantitativas envolvidas no glaucoma. Estes estudos de associação do genoma tem identificado variações nas regiões perto dos genes CDC7/TGFBR3, CARD10, ATOH7, SIX1, SALL1 que tem sido associados com área do disco óptico e relação escavação/disco (KHOR et al., 2011)(MACGREGOR et al., 2010)(RAMDAS et al., 2010). Associação também tem sido encontrada entre espessura central da córnea e variações em ZNF469, COL5A1, COL8A2, COL4A3, AKAP13, RPN2, FNDC3B, FOXO1, LOC100506532 (GAO et al., 2013)(LU et al., 2010)(LU Y; VITART; BURDON, 2013)(SCHEETZ et al., 2013)(VITART et al., 2010)(VITHANA et al., 2011). Muitos estudos tem investigado a associação de pressão intraocular e variação genética por ser o maior fator de risco para o glaucoma. Resultados destes estudos tem mostrado forte associação entre pressão intraocular e variações nos genes GAS7 e TMCO1 (OZEL et al., 2014)(VAN KOOLWIJK et al., 2012).

  Um grande número de estudos tem identificado genes e variantes associados ao glaucoma. C7 (SCHEETZ et al., 2013), CAV1 e CAV2(WIGGS et al., 2011), CDKN2B-AS e SIX1/SIX6 (WIGGS, 2012), também tem sido associado ao glaucoma primário de ângulo aberto. Recentemente, o papel do ABCA1 na patologia do glaucoma de ângulo aberto tem sido identificado (GAASTERLAND et al., 2014)(EUROPE PMC FUNDERS GROUP, 2014). Estes estudos também identificaram variações no TMCO1, CAV1, GAS7, PMM2, AFAP1, E GMDS e ABCA1 que foi uma característica comum entre os artigos (DOUCETTE et al., 2015b).

  1.5 Óxido nítrico sintetase (NOS)

  Estudos prévios sugerem que desregulação vascular tem importante papel na etiologia do glaucoma (LOGAN et al., 2005)(HAYREH et al., 1994). Ativação da óxido nítrico sintetase (NOS), uma enzima associada com a morte das células ganglionares da retina causada por injúria isquêmicas, tem sido reportada como um mecanismo potencial de dano glaucomatoso da retina e nervo óptico (KARANTZOULIS-FEGARAS et al., 1999)(BECQUET; COURTOIS; GOUREAU, 1997).

  Polimorfismos no gene da sintetase óxido nítrico endotelial (eNOS) pode alterar sua expressão, causar uma diminuição na síntese de óxido nítrico (ON) e assim estar relacionado a doença cardiovascular (LOGAN et al., 2005)(COHEN, 1995). Não obstante, uma grande quantidade de ON tem sido encontrada nos vasos da cabeça do nervo óptico de pacientes com glaucoma primário, dando suporte a ideia de que dano no nervo óptico no glaucoma pode estar relacionado com o excesso de expressão da NOS (NEUFELD; HERNANDEZ; GONZALEZ, 1997).

1.5.1 Formação e função do ON

  Para coordenar atividades intercelular e intracelular, os seres vivos tem desenvolvido sistemas de sinalizações químicos complexos. Sinais intercelulares são geralmente mediados por mensageiros químicos conhecidos como hormônios ou neurotransmissores, enquanto sinais intracelulares são usualmente mediados por segundos mensageiros (VOET; VOET, 1995). No contexto de comunicação bioquímica, o óxido nítrico é um mediador celular que tem sido identificado recentemente e que atua primariamente como hormônio ou neurotransmissor (BECQUET; COURTOIS; GOUREAU, 1997).

  Óxido nítrico está envolvido na regulação da pressão intraocular (BEHAR-COHEN et al., 1996)(CAVET et al., 2014), modulação do fluxo sanguíneo ocular (HAEFLIGER; FLAMMER; LUSCHER, 1992)(HAEFLIGER et al., 1994)(MANN et al., 1995)e controle da morte das células ganglionares da retina por apoptose (GARCIA-VALENZUELA et al., 1995)(GOLDSTEIN; OSTWALD; ROTH, 1996)(KASHII et al., 1996)(QUIGLEY; DUNKELBERGER; GREEN, 1988)(QUIGLEY et al., 1995).

  A eNOS tem L-arginina como principal substrato que leva a formação do óxido nítrico e L-citrulina (STANKEVICIUS et al., 2003). A formação de óxido nítrico pode ser inibida por análogos de L-arginina, como as N-nitro-L-arginina metil ester (L-NAME) ou N-monometil- L-arginina(L-NMMA), as quais atuam como inibidores competitivos da enzima conversora de oxido nítrico e, assim, inibe a produção do óxido nítrico (LO et al., 2016)(BALLIGAND et al., 1993)(BECQUET; COURTOIS; GOUREAU, 1997).

  Em contraste com outros hormônios ou neurotransmissores, os quais são geralmente polipeptídios, derivados de aminoácidos, ou esteróides, o óxido nítrico é um gás radical livre inorgânico. Como o 0 ₂ e CO₂, os quais são moléculas lipofílicas, o óxido nítrico difunde através das membranas celulares, não podem ser estocadas em vesículas e não podem atuar em receptores específicos de membrana. Desta maneira, o óxido nítrico produzido em uma simples célula endotelial pode se difundir rapidamente e penetrar nas células ao redor (THOMAS et al., 2008)(HAEFLIGER et al., 1999)(BECQUET; COURTOIS; GOUREAU, 1997).

  O óxido nítrico é muito instável e tem uma meia-vida de poucos segundos, assim tem uma área de atividade limitada a uma região perto do seu sitio de produção. Em particular, o óxido nítrico pode reagir com oxigênio para formar outras formas de nitrito e nitrato ou com a hemoglobina, a qual atua como uma limpadora de óxido nítrico (HAEFLIGEF; ANDERSON, 1997)(THOMAS et al., 2008). Na presença de radicais livres, como os ânions superóxidos, formam produtos tóxicos como os peróxido de nitrito e o radical de hidroxila (THOMAS et al., 2008)(ALLEN; KENG; PRIVALLE, 1998)(DEMIRYUREK; CAKICI; KANZIK, 1998)(MURPHY et al., 1998). Também pode ocorrer a interação do óxido nítrico com o cobre e ferro, levando a produção de produtos tóxicos (HOGG; KALYANARAMAN, 1999).

  Nas células endoteliais dos vasos sanguíneos, depois da estimulação do receptor presente em sua membrana plasmática, ocorre aumento de cálcio intracelular, ativação da enzima conversora de oxido nítrico (eNOS) e assim produção de óxido nítrico (STANKEVICIUS et al., 2003)(HAEFLIGER et al., 1999)(Fig.2).

  Quando o óxido nítrico alcança sua célula alvo, exemplo, célula do músculo liso, ativa a enzima guanilato ciclase, a qual é responsável pela produção da 3’ 5’ monofostato de guanosina cíclico (cGMP), um segundo mensageiro. O aumento da cGMP leva relaxamento do músculo liso por reduzir o cálcio intracelular (HAEFLIGER; ZSCHAUER; ANDERSON, 1994)(HAEFLIGER et al., 1999) (Fig.2).

  

Fig.2. Esquema da ação do óxido nítrico nos vasos sanguíneos. Nas células endoteliais a ativação do receptor

presente na membrana plasmática leva a um influxo de cálcio. O aumento de cálcio ativa a eNOS, a qual é

responsável pela produção de óxido nítrico tendo como substrato a L-arginina. O óxido nítrico se difunde através

do músculo liso e ativa a enzima guanilato ciclase (GC), a qual é responsável pela produção do segundo mensageiro

chamado de GMP cíclico (cGMP), levando a relaxamento do músculo liso através da diminuição do cálcio

intracelular. Fonte: adaptado de (HAEFLIGER et al., 1999)(WIGGS; PASQUALE, 2017) .

1.5.2 Isoformas de NOS

  Além da enzima conversora de óxido nítrico nas células endoteliais (eNOS), existe duas outras isoformas de NOS (THOMAS et al., 2008)(BECQUET; COURTOIS; GOUREAU, 1997)(HAEFLIGER et al., 1999). Veja tabela 2.

  Tabela 2: Isoformas de NOS.

  Isoenzima Tecido Regulação Função nNOS Cérebro Calmodulina e Regulação da sinapse neuronal, regulação cálcio da pressão sanguínea central, relaxamento da musculatura lisa e vasodilatação iNOS Macrófagos Citocinas e Citotoxicidade lipopolissacarideos eNOS Endotélio Calmodulina e Dilatação dos vasos sanguíneos e cálcio prevenção da adesão plaquetária

  Fonte: adaptada de (HAEFLIGER et al., 1999)

  Uma delas é neuronal NOS (nNOS), a qual pode ser encontrada em neurônios não- adrenérgicos não-colinérgicos; estes nervos podem estar ao redor de certos vasos e ser responsável pelo relaxamento das células musculares lisas e, assim, vasodilatação, em particular, na circulação da coroide (BECQUET; COURTOIS; GOUREAU, 1997)(HAEFLIGER et al., 1999)(Fig.3).

  

Fig.3. Mecanismo de ação da óxido nítrico sintetase neuronal (nNOS) que pode ser encontrado em neurônios pré-

sinápticos e pós-sinápticos. Esquerda: em alguns neurônios pré-sinápticos não adrenérgicos não colinérgicos o

potencial de ação leva a influxo de cálcio com ativação da nNOS e produção de óxido nítrico. O óxido nítrico ativa

a guanilato ciclase (GC) nas células musculares lisas dos vasos sanguíneos após difusão e assim leva a aumento

do GMP cíclico e consequente vasodilatação. Direita: Ativação do receptor NMDA (N-metil-d-aspartato) pós-

sináptico pelo glutamato leva a aumento do cálcio intracelular e ativação da nNOS a produzir óxido nítrico. Fonte:

adaptado de (HAEFLIGER et al., 1999)(WIGGS; PASQUALE, 2017).

  Em contraste com a eNOS e nNOS, a terceira isoforma, chamada de NOS induzida (iNOS), não é expressa em condições normais mas apenas depois de exposição a citocinas ou produtos bacterianos, como endotoxinas. A iNOS está primariamente envolvida em processos inflamatórios. Em macrófagos e neutrófilos após exposição a citocinas ou endotoxinas, estas células começam a produzir grande quantidade de óxido nítrico e continuam a sua síntese por várias horas (BECQUET; COURTOIS; GOUREAU, 1997).

  As mesmas células também podem produzir ânions superóxidos (O₂⁻), os quais combinam quimicamente com o óxido nítrico para formar ânion peroxinitrito tó xico (OONO⁻), que é instável e decompõem rapidamente para formar mais radicais hidróxidos tóxicos (OH⁻) usados para matar as bactérias fagocitadas. A ação citotóxica dos macrófagos podem ser bloqueadas por inibidores de enzima conversora de óxido nítrico (TSAI et al., 1997), e o óxido nítrico tem sido implicado na vasodilatação observada no choque hemotóxico (PICKKERS et al., 2006) (Fig.4).

  

Fig.4. Mecanismo de ação da óxido nítrico sintetase induzida (iNOS ou NOS II) em macrófagos. Citocinas leva a

transcrição de RNA mensageiro devido ativação do gene da NOS II no núcleo. Com a formação de iNOS ocorre

a produção de grande quantidade de oxido nítrico que interage com ânion superóxido formando o peróxido nitrito

e radicais hidróxidos que são muito tóxicos e assim podem ser usados para matar bactérias fagocitadas. Fonte:

adaptado de (HAEFLIGER et al., 1999)(WIGGS; PASQUALE, 2017).

  Sob algumas condições patológicas, como por exemplo, em casos de disfunção endotelial pode ocorrer diminuição na produção de oxido nítrico, reação de vaso espasmos, diminuição do fluxo sanguíneo na cabeça do nervo óptico e consequentemente neuropatia óptica glaucomatosa (HAEFLIGER; FLAMMER; LUSCHER, 1993).

  As três isoformas de NOS tem sido relatadas em quantidades significativas em quase todas as camadas da retina (KARANTZOULIS-FEGARAS et al., 1999)(BECQUET; COURTOIS; GOUREAU, 1997)(Fig.5)

  

NOS induzida NOS constitutiva

Endotélio vascular Epitélio pigmentar da retina

  Fotoreceptores Células de Células Muller horizontais Células amácrinas Pericitos

  Endotélio vascular Fig.5. Localização das diferentes isoformas de NOS na retina. Fonte: adaptado de (BECQUET; COURTOIS; GOUREAU, 1997).

  Há também evidência de que a malha trabecular tem elementos de contratilidade intrínseca e que pode relaxar em resposta ao óxido nítrico. Devido estas propriedades de contração e relaxamento, tem sido sugerido que a malha trabecular pode participar na regulação do fluxo do humor aquoso e que o óxido nítrico pode aumentar a saída do humor aquoso, e, assim, reduzir a pressão intraocular (CAVET et al., 2014).

  No glaucoma a perda de células ganglionares da retina pode ocorrer através de um processo chamado de apoptose (GARCIA-VALENZUELA et al., 1995)(QUIGLEY; DUNKELBERGER; GREEN, 1988). Sob influência de diferentes fatores, mecanismos geneticamente programados podem ser ativados nas células ganglionares da retina, levando as células a um tipo de “suicídio” e morrer rapidamente sem provocar qualquer reação inflamatória. Apoptose pode ser induzida pela ligação do glutamato no receptor de membrana N-metil-d-aspartato (NMDA)(VORWERK et al., 1997), o qual estimula a produção de grande quantidade de óxido nítrico (muito mais do que é produzido em condições fisiológicas), e também de radicais livres superóxido nas mitocôndrias. Como nos macrófagos, o óxido nítrico pode reagir com o superóxido para formar produtos muito tóxicos, como o peróxido nitrito, o qual pode ser o gatilho para indução da apoptose (BONFOCO et al., 1995)(BRÜNE; VON KNETHEN; SANDAU, 1998)(LÓPEZ-FARRÉ et al., 1998)(RICHTER, 1998) (ROTH S, 1997).

  No corpo vítreo de pacientes com glaucoma, foi mensurado níveis aumentados de glutamato. Também tem sido demonstrado que as células ganglionares da retina são mais susceptíveis a neurotoxicidade mediada pelo receptor NMDA (OSBORNE et al., 2001).

1.5.3 Polimorfismo da eNOS (G894T)

  Neste estudo iremos avaliar a associação do polimorfismo da eNOS com glaucoma primário de ângulo aberto. Dentre os polimorfismos mais importantes já identificados encontra- se o SNP (polimorfismo de nucleotídeo único) onde o G é substituído pelo T no exon 7 levando a uma mudança no aminoácido da eNOS (Glu298Asp, rsl1799983) (MARSDEN P.A, 1993) (Fig.6). Devido a alteração morfológica da enzima causada pela troca de aminoácido, ocorre diminuição da sua função, consequentemente menor quantidade de óxido nítrico na malha trabecular, diminuição da drenagem do humor aquoso no trabeculado, aumento da PIO e consequentemente glaucoma primário de ângulo aberto (HAEFLIGER et al., 1999) (EMAM et al., 2014)(GOLSER R et al., 2003).

  

Fig.6 Figura esquemática do gene que codifica a eNOS. O gene humano da eNOS contem 26 exons de 21 kilobases

localizado no 7q35-36. Os exons estão descritos pelos números. Polimorfismos específicos no genes da eNOS

estão assinalados pelas setas. (Fonte: adaptado de HINGORANI et al., 1999)

2. OBJETIVOS

2.1 OBJETIVOS GERAIS

  Analisar o polimorfismo do gene eNOS (G894T) nos grupos de indivíduos com diagnóstico de glaucoma primário de ângulo aberto e grupo controle.

2.2 OBJETIVOS ESPECÍFICOS

   Detectar o polimorfismo dos genes da eNOS (G894T)) nos grupos caso e controle  Verificar a distribuição do polimorfismo dos genes da eNOS (G894T)) após estratificação por gênero, diabetes, hipertensão arterial sistêmica e etnia.

3. MATERIAIS E MÉTODOS

  3.1 Casuística

  Os pacientes com glaucoma primário de ângulo aberto foram randomicamente selecionados do ambulatório de glaucoma e os pacientes sem glaucoma foram selecionados do ambulatório de oftalmologia geral, ambos das Fundação Banco de Olhos de Goiás Goiânia Brasil no período de fevereiro de 2016 a abril de 2016. Foi incluído 84 pacientes sem glaucoma e 32 pacientes com glaucoma primário de ângulo aberto.

  Os pacientes foram selecionados com base em suas histórias clínicas, avaliação da relação escavação/disco (E/D) sob midríase, do campo visual (Humphry Field Analyzer), paquimetria (Echoscan US-400), pressão intraocular (tonômetro de aplanação) e gonioscopia. E para descartar outras doenças oculares, os pacientes também eram submetidos a exame de lâmpada de fenda, motilidade ocular, mapeamento de retina e acuidade visual (LIAO; WANG; SUN, 2011)(EMAM et al., 2014).

  Os pacientes com glaucoma eram brasileiros, com idade acima de 40 anos, ângulo da câmara anterior aberto (identificação do corpo ciliar nos quatro quadrantes), PIO maior que 21 mmHg antes do início do tratamento e alterações de nervo óptico e campo visual compatível com dano glaucomatoso. Exclusão de pacientes com outras formas de glaucoma (congênito, pigmentado, pseudoexfoliativo, pós uveite, pós trauma, induzido por corticoide, etc), hipertenso ocular (PIO acima de 21 com nervo optico e campo visual normal) e glaucoma de início antes dos 40 anos.

  Todos os controles apresentavam idade superior a 65 anos, E/D ≤ 0,5, Idade ≥ 65 anos, sem antecedentes de glaucoma e PIO ≤ 18.

  O estudo foi aprovado pela Comissão Nacional de Ética em Pesquisa/ Sistema Nacional de Informações Sobre Éticas em Pesquisas envolvendo Seres Humanos CEP/PUC GOIAS, 56495216.9.0000.0037. O termo consentimento livre e esclarecido foi assinado por cada participante.

  3.2 Coleta, extração e quantificação do DNA genômico

  Amostras de sangue periférico venoso foram coletados em tubos contendo heparina e levados ao Laboratório do Núcleo de Pesquisas Replicon da Pontifícia Universidade Católica de Goiás afim de serem armazenadas em criotubos, preservados a -20°C, para posterior extração do DNA.

  A obtenção do DNA foi realizada utilizando-se o kit Kaswi® (Genomic DNA

  Purification Kit

  ), em seguida os produtos da extração foram quantificados no espectofotômetro NanoVue™ Plus (GE, Cambridge, UK), sendo selecionadas apenas as amostras cujas concentrações fossem superiores a 5ng/µl depois as mesmas foram submetidas à técnica da Reação em Cadeia Polimerase (PCR).

3.3 Reação em Cadeia da Polimerase - PCR

  Para o estudo do polimorfismo G894T foi empregado o método da PCR (Polymerase

  Chain Reaction

  • – PCR), feita em capela de fluxo laminar buscando a minimização da contaminação, sendo o volume final foi de 25uL, de acordo com o protocolo proposto por Frare (2011). Foram preparados dois mix de PCR para cada amostra, um para a pesquisa do alelo selvagem (usando os primers forward e reverse) e o outro para o alelo polimórfico (usando primer forward e mutante) (tabela 3).

  

Reagentes Concentração Vol. p/ 1 amostra

Tampão (10X) MgCl 2 (50 mM) dNTPs Taq polimerase 5 U/μL Primer forward Primer reverse H 2 O Mili Q DNA amostra

  Tabela 3: Primer usado para genotipagem do polimorfismo da sintetase oxido nítrico endotelial (eNOS)

Fonte: adaptado de (TAJEHMIRI et al., 2016)(MEHRTASHFAR; SCIENCES, 2014) (EMAM et al.,

2014)(LUIZON et al., 2009) Tabela 4 Protocolo do polimorfismo G894T para alelo selvagem.

  20 pM 20 pM 200 ng/ μL 2,5 μL

  1,0 μL 0,5 μL de cada = 2,0 μL 0,5 μL 1,0

  μL 1,0 μL 14 μL

  3 ,0 μL Volume final

  25,0 μL Nome do gene G894T

  Pr Primer (5’ - 3’) F c : 5’ AGGCCCAGCAAGGATGTAGT 3’ R N

  : 5’ TGAAGGAAGAGTTCTGGTGGC 3’ R M : 5’ TGAAGGAAGAGTTCTGGTGGA 3’

  1X 1,5 mM 3,0 mM de cada 2,5 U/μL

  Tabela 5 Protocolo do polimorfismo G894T para alelo polimórfico.

  

Reagentes Concentração Vol. p/ 1 amostra

Tampão (10X)

  1X 2,5 μL MgCl 2 (50 mM) 1,5 mM 1,0 μL dNTPs 1,25 mM de cada 0,5 μL de cada = 2,0 μL Taq polimerase 5 U/μL 2,5 U/μL 0,5 μL Primer forward 20 pM 1,0 μL Primer mutante 20 pM 1,0 μL H 2 O Mili Q

  14 μL DNA amostra 200 ng/ μL 3 ,0 μL

  Volume final 25,0 μL

  Para o protocolo da termociclagem do polimorfismo G894T do gene eNOS foi utilizado 94ºC por 5 minutos na primeira etapa de desnaturação, seguido de 35 ciclos de 94°C por 1 minuto, 56°C por 90 segundos e 72°C por 1 minuto e uma extensão final a 72°C por 7 minutos (Tabela 6). Tabela 6 -

  Protocolo de termociclagem para amplificação dos primers do polimorfismo G894T do gene eNOS para técnica de PCR Temperatura (ºC) Tempo (minutos) Ciclos Desnaturação inicial 94ºC

  5

  1 Desnaturação 94ºC

  1 Anelamento 56ºC 1,5

  35 Polimerização 72ºC

  1 Extensão final 72ºC

  7

  1 Armazenamento 4ºC ∞

  Como controle positivo para as PCRs foi utilizado DNA de individuo com a presença confirmada dos polimorfismos G894T do gene eNOS (EMAM et al., 2014).

  Os amplicons foram submetidos à eletroforese em gel agarose 2% com solução Tris- borato de EDTA (TBE) a 1x. Os géis foram corados com brometo de etídio (5μg/mL) e visualizados no Sistema de Vídeo Documentação VDS® (Image Master VD® - Amersham ) (Figuras 7 e 8).

  Pharmacia Biotech, EUA 181 pb

  

Figura 7. Gel de agarose a 2%, corado com brometo de etídeo, indicando a presença ou ausência do alelo selvagem

(G) do polimorfismo G894T do gene eNOS. O ladder (LD) confirma que os fragmentos amplificados s ão constitu ídos por 181pb. As colunas de 1 a 4 mostram a amplificação da banda.

  171 pb

Figura 8. Gel de agarose a 2%, corado com brometo de etídeo, indicando a presença ou ausência do alelo

polimórfico (T) do polimorfismo G894T do gene eNOS. O ladder confirma que os fragmentos amplificados são

constituídos por 171 pb. As colunas de 15, 19, 20 e 21 mostram a amplificação da banda.

  A amplificação da banda da PCR que utilizou os primers forward e reverse confirmou a presença do alelo selvagem (G), e a da amplificação da banda cuja PCR utilizou os primers e mutante confirmou a presença do alelo polimórfico (T), dessa forma foram

  forward necessárias duas PCRs para cada amostra. Sendo assim os genótipos foram: GG, GT ou TT.

3.4 Análise de dados

  Os dados foram processados usando o pacote estatístico do BioEstat. Variáveis continuas foram convertidas em médias +/- desvio padrão e comparadas com teste de t Student (gênero e idade). Variáveis de categorias foram expressas em porcentagem. O teste do Qui-quadrado, teste G e exato de Fisher foi usado para comparar a distribuição de gêneros e para testar a associação entre os genótipos e alelos em relação aos casos e controles. O valor de p< 0,05 foi considerado estatisticamente significativo.

4. RESULTADOS

  A idade do grupo controle (sem glaucoma) variou de 65 a 86 anos com uma média de 72,2±5,3 anos e com 52,4% homens e 47,6% mulheres. A idade dos pacientes com glaucoma foi de 65 a 89 anos com uma média de 72,7±5,9 anos e com 56,3% homens e 43,7% mulheres.

  Não houve diferença estatisticamente significativa em relação a idade ou gênero ao comparar os grupos de casos e controle (tabela 7).

  Tabela 7 - Características demográficas dos pacientes casos (n=32) e controles (84).

  Caso Controle p Idade média 72,7 72,2 0,62* Sexo n % n % Masculino 18 56,3 44 52,4 Feminino 14 43,7 40 47,6 0,7** Total 32 100 84 100

  • teste t de Student **Teste do Qui-quadrado

  Na investigação do polimorfismo G894T do gene eNOS foi encontrado no grupo caso 0% (0/32) de homozigotos para o alelo selvagem (GG), 93,75% (30/32) de heterozigotos (GT) e 6,25% (2/32) homozigotos para o alelo polimórfico (TT). No grupo controle foi encontrado 9,52% (8/84) de homozigotos para o alelo selvagem (GG), 82,14% (69/84) de heterozigotos (GT) e 8,33% (7/84) de homozigotos para o alelo polimórfico (TT). Não houve diferença estatística significante, pois p = 0,17 (Tabela 8).

  Tabela 8

Distribuição genotípica do Polimorfismo do gene eNOS (G894T) nos grupos caso e controle.

  GG GT TT Total p* n % n % n % n % Caso 30 93,75 2 6,25 32 100 0,17

  Controle 8 9,52 69 82,14 7 8,33 84 100

  • Teste G

  Quanto a frequência alélica do gene eNOS (G894T) no grupo caso foi encontrado 46,8% do alelo selvagem (G) e 53% do alelo T, já no grupo controle a frequência do alelo G foi de 50,5% e 49,5% do alelo T. Não houve diferença estatística significante, pois p = 0,87 (Tabela 9).

   Tabela 9

– Distribuição gênica dos alelos G e T do gene eNOS (G894T) nos grupos caso e controle.

  G T Total

  p*

  n % n % n % Caso 30 46,8 34 53,2 64 100 0,87 Controle 85 50,5 83 49,5 168 100

  • teste Qui-quadrado

  Na investigação do polimorfismo G894T do gene eNOS dos pacientes do sexo masculino foi encontrado no grupo caso 0% (0/18) de homozigotos para o alelo selvagem (GG), 100% (18/18) de heterozigotos (GT) e 0% (0/18) homozigotos para o alelo polimórfico (TT). No grupo controle foi encontrado 11,36% (5/44) de homozigotos para o alelo selvagem (GG), 84,1% (37/44) de heterozigotos (GT) e 4,54% (2/44) de homozigotos para o alelo polimórfico (TT). Não houve diferença estatística significante, pois p = 0,19 (Tabela 10).

  Tabela 10

  • Distribuição genotípica do Polimorfismo do gene eNOS (G894T) nos grupos caso e controle em pacientes do sexo masculino.

  GG GT TT Total

  p*

  n % n % n % n % Caso 18 100 18 100 0,19

  Controle 5 11,36 37 84,1 2 4,54 44 100

  • Teste G

  Na investigação do polimorfismo G894T do gene eNOS dos pacientes do sexo feminino foi encontrado no grupo caso 0% (0/14) de homozigotos para o alelo selvagem (GG), 85,7% (12/14) de heterozigotos (GT) e 14,3% (2/14) homozigotos para o alelo polimórfico (TT). No grupo controle foi encontrado 7,5% (3/40) de homozigotos para o alelo selvagem (GG), 80% (32/40) de heterozigotos (GT) e 12,5% (5/40) de homozigotos para o alelo polimórfico (TT). Não houve diferença estatística significante, pois p = 0,57 (Tabela 11).

  Tabela 11

  • Distribuição genotípica do Polimorfismo do gene eNOS (G894T) nos grupos caso e controle em pacientes do sexo feminino.

  GG GT TT Total

  p*

  n % n % n % n % Caso 12 85,7 2 14,3 14 100 0,57

  Controle 3 7,5

  32

  80 5 12,5 40 100

  • Teste G

  Quanto a frequência alélica do gene eNOS (G894T) no grupo caso de pacientes do sexo masculino foi encontrado 50% do alelo selvagem (G) e 50% do alelo T, já no grupo controle a frequência do alelo G foi de 53,4% e 46,6% do alelo T. Não houve diferença estatística significante, pois p = 0,94 (Tabela 12).

  

Tabela 12 – Distribuição gênica dos alelos G e T do gene eNOS (G894T) nos grupos caso e controle em pacientes

do sexo masculino.

  G T Total p* n % n % n % Caso

  18

  50

  18

  50 36 100 0,94 Controle 47 53,4 41 46,6 88 100

  • teste Qui-quadrado

  Quanto a frequência alélica do gene eNOS (G894T) no grupo caso de pacientes do sexo feminino foi encontrado 42,8% do alelo selvagem (G) e 57,2% do alelo T, já no grupo controle a frequência do alelo G foi de 47,5% e 52,5% do alelo T. Não houve diferença estatística significante, pois p = 0,67 (Tabela 13).

  Tabela 13

  • – Distribuição gênica dos alelos G e T do gene eNOS (G894T) nos grupos caso e controle em pacientes do sexo feminino.

  G T Total

  p*

  n % n % n % Caso 12 42,8 16 57,2 28 100 0,67 Controle 38 47,5 42 52,5 80 100

  • teste Qui-quadrado

  Na investigação do polimorfismo G894T do gene eNOS dos pacientes com diabetes mellitus foi encontrado no grupo caso 0% (0/6) de homozigotos para o alelo selvagem (GG), 100% (6/6) de heterozigotos (GT) e 0% (0/6) homozigotos para o alelo polimórfico (TT). No grupo controle foi encontrado 0% (0/27) de homozigotos para o alelo selvagem (GG), 92,6% (25/27) de heterozigotos (GT) e 7,4% (2/27) de homozigotos para o alelo polimórfico (TT). Não houve diferença estatística significante, pois p = 0,66 (Tabela 14).

  Tabela 14

  • Distribuição genotípica do Polimorfismo do gene eNOS (G894T) nos grupos caso e controle em pacientes com diabetes.

  GG GT TT Total

  p*

  n % n % n % n % Caso 6 100 6 100 0,66

  Controle 25 92,6 2 7,4 27 100

  • Teste G

  Quanto a frequência alélica do gene eNOS (G894T) no grupo caso de pacientes com diabetes mellitus foi encontrado 50% do alelo selvagem (G) e 50% do alelo T, já no grupo controle a frequência do alelo G foi de 46,4% e 53,6% do alelo T. Não houve diferença estatística significante, pois p = 0,82 (Tabela 15).

  

Tabela 15 – Distribuição gênica dos alelos G e T do gene eNOS (G894T) nos grupos caso e controle em pacientes

do diabetes.

  G T Total p* n % n % n % Caso

  6

  50

  6

  50 12 100 0,82 Controle 26 46,4 30 53,6 56 100

  • teste Qui-quadrado

  Na investigação do polimorfismo G894T do gene eNOS dos pacientes com hipertensão arterial sistêmica foi encontrado no grupo caso 0% (0/15) de homozigotos para o alelo selvagem

  polimórfico

  (GG), 93,4% (14/15) de heterozigotos (GT) e 6,6% (1/15) homozigotos para o alelo (TT). No grupo controle foi encontrado 8,6% (4/46) de homozigotos para o alelo selvagem (GG), 80,4% (37/46) de heterozigotos (GT) e 11% (5/46) de homozigotos para o alelo polimórfico (TT). Não houve diferença estatística significante, pois p = 0,259 (Tabela 16).

  Tabela 16

  • Distribuição genotípica do Polimorfismo do gene eNOS (G894T) nos grupos caso e controle em pacientes com hipertensão arterial sistêmica.

  GG GT TT Total

  p*

  n % n % n % n % Caso 14 93,4 1 6,6 15 100 0,259

  Controle 4 8,6 37 80,4

  5

  11 46 100

  • Teste G

  Quanto a frequência alélica do gene eNOS (G894T) no grupo caso de pacientes com hipertensão arterial sistêmica foi encontrado 46% do alelo selvagem (G) e 54% do alelo T, já no grupo controle a frequência do alelo G foi de 48% e 52% do alelo T. Não houve diferença estatística significante, pois p = 0,86 (Tabela 17).

  Tabela 17

  • – Distribuição gênica dos alelos G e T do gene eNOS (G894T) nos grupos caso e controle em pacientes com hipertensão arterial sistêmica.

  G T Total p* n % n % n % Caso

  14

  46

  16

  54 30 100 0,86 Controle

  45

  48

  48

  52 93 100

  • teste Qui-quadrado

  Na investigação do polimorfismo G894T do gene eNOS dos pacientes brancos foi encontrado no grupo caso 0% (0/24) de homozigotos para o alelo selvagem (GG), 91,6% (22/24) de heterozigotos (GT) e 8,4% (2/24) homozigotos para o alelo polimórfico (TT). No grupo controle foi encontrado 14% (5/36) de homozigotos para o alelo selvagem (GG), 92% (28/36) de heterozigotos (GT) e 8% (3/36) de homozigotos para o alelo polimórfico (TT). Não houve diferença estatística significante, pois p = 0,06 (Tabela 18).

  Tabela 18

  • Distribuição genotípica do Polimorfismo do gene eNOS (G894T) nos grupos caso e controle em pacientes brancos.

  GG GT TT Total p* n % n % n % n % Caso 22 91,6 2 8,4 24 100 0,06

  Controle

  5

  14

  28

  92

  3

  8 36 100

  • Teste G

  Na investigação do polimorfismo G894T do gene eNOS dos pacientes negros foi encontrado no grupo caso 0% (0/8) de homozigotos para o alelo selvagem (GG), 91,6% (4/8) de heterozigotos (GT) e 8,4% (0/8) homozigotos para o alelo polimórfico (TT). No grupo controle foi encontrado 14% (2/22) de homozigotos para o alelo selvagem (GG), 92% (18/22) de heterozigotos (GT) e 8% (2/22) de homozigotos para o alelo polimórfico (TT). Não houve diferença estatística significante, pois p = 0,48 (Tabela 19).

  Tabela 19

  • Distribuição genotípica do Polimorfismo do gene eNOS (G894T) nos grupos caso e controle em pacientes negros.

  GG GT TT Total

  p*

  n % n % n % n % Caso 4 91,6 8,4 8 100 0,48

  Controle

  2

  14

  18

  92

  2

  8 22 100

  • Teste G

  Na investigação do polimorfismo G894T do gene eNOS dos pacientes pardos foi encontrado no grupo caso 0% (0/4) de homozigotos para o alelo selvagem (GG), 100% (4/4) de heterozigotos (GT) e 0% (0/4) homozigotos para o alelo polimórfico (TT). No grupo controle foi encontrado 3,8% (1/26) de homozigotos para o alelo selvagem (GG), 88,5% (23/26) de

  polimórfico

  heterozigotos (GT) e 7,7% (2/26) de homozigotos para o alelo (TT). Não houve diferença estatística significante, pois p = 0,63 (Tabela 20).

  Tabela 20

  • Distribuição genotípica do Polimorfismo do gene eNOS (G894T) nos grupos caso e controle em pacientes pardos.

  GG GT TT Total p* n % n % n % n % Caso 4 100 4 100 0,63

  Controle 1 3,8 23 88,5 2 7,7 26 100

  • Teste G

5. DISCUSSÃO:

  Glaucoma é a principal doença dentre as neuropatias ópticas e a segunda causa de cegueira do mundo. A lenta e progressiva perda de células ganglionares da retina leva a perda de visão periférica e em uma fase tardia a cegueira total. É uma doença multifatorial e sua etiologia exata permanece desconhecida. Tem sido relatado que fatores genéticos e ambientais são responsáveis pelo início e progressão da doença (HOWELL et al., 2013).

  Emam e colaboradores (2014) analizaram a associação do polimorfismos G894T do gene eNOS e a concentração sanguínea de óxido nítrico (NO) com glaucoma primario de ângulo aberto (GPAA) em uma população egípcia. Foram estudados 160 pacientes com glaucoma e 110 controles. O genótipo e as freqüências alélicas do G894T não apresentaram diferenças estatísticamente significativas entre os pacientes com GPAA e os controles mesmo após estratificação por sexo (EMAM et al., 2014) semelhante ao nosso estudo.

  Também Kang e colaboradores (2011) avaliou a associação do polimorfismo G894T da eNOS com glaucoma primario de angulo aberto (GPAA) e se fatores como hipertenção arterial, etilismo e tabagismo altera de alguma forma a relação entre o polimorfismo G894T e o GPAA. Foram incluídos 527 casos de glaucoma e 1539 controles, com idade acima de 40 anos e caucasisanos. Não foi encontrado associação entre polimorfismo G894T do gene eNOS e glaucoma primario de angulo aberto ou quando se avalia sexo feminino e masculino de forma separada. Da mesma forma não foi identificado interação do polimorfismo G894T do gene eNOS e GPAA em pacientes com hipertensão arterial, tabagismo e consumo de álcool (KANG et al., 2011). De forma semelhante ao nosso estudo, pois também não identificamos associação estatisticamente significativa entre o polimorfismo G894T do gene eNOS com glaucoma primário de ângulo aberto no geral, após estratificação por gênero e hipertensão arterial sistêmica.

  Kosior-Jarecka e colaboradores (2016) analisaram a influência do polimorfismo G894T do gene eNOS na evolução clínica dos pacientes com glaucoma primário de ângulo aberto de pressão normal (GPN) e glaucoma primário de ângulo aberto de pressão alta (GPA). Foram estudados 156 pacientes caucasianos com GPN e 110 pacientes caucasianos com GPA. O polimorfismo G894T não influenciou de forma estatisticamente significativa a taxa de progressão do glaucoma, necessidades de cirurgia e a taxa de sucesso cirúrgico em nenhum dos grupos estudados. No grupo GPN, não houve correlação estatística entre o polimorfismo G894T e fatores de risco como hemorragias de disco óptico, perda de rima neural e atrofia peripapilar

  (KOSIOR-JARECKA et al., 2016). Assim podemos concluir que além de não ser identificado associação estatisticamente significativa entre o polimorfismo G894T da eNOS com glaucoma primário de ângulo aberto (EMAM et al., 2014)(KANG et al., 2011) este polimorfismo não altera a evolução clínica dos pacientes com glaucoma primário de ângulo aberto de pressão normal (GPN) e glaucoma primário de ângulo aberto de pressão alta (GPA).

  Entretanto Magalhães e colaboradores (2012) realizou um estudo de caso-controle no Brasil com 90 pacientes portadores de GPAA e 127 controles saudáveis cujas amostras de sangue foram genotipadas para os polimorfismos funcionais T786C e G894T do gene eNOS.

  O polimorfismo T786C foi significativamente associado como fator de risco para o GPAA entre mulheres e de forma limítrofe nos pacientes que tiveram o diagnostico de glaucoma com idade igual ou superior a 52 anos.O polimorfismo G894T mostrou uma associação limítrofe com risco de GPAA na análise global e entre mulheres. Assim estes autores sugerem que o polimorfismo T786C e G894T da eNOS podem interagir com gênero e idade na modulação do risco de GPAA (MAGALHAES DA SILVA et al., 2012). Diferente do nosso estudo pois nâo identificamos associação genotípica ou alélica estatisticamente significativa entre o polimorfismo G894T da eNOS com glaucoma primário de ângulo aberto mesmo após estratificação por gênero. De forma semelhante nâo identificamos associação estatisticamente significativa após estratificação por etnia. Assim, acreditamos que no Brasil também não exista associação entre o polimorfismo G894T da eNOS com glaucoma primário de ângulo aberto como demonstrado em trabalhos internacionais (EMAM et al., 2014)(KANG et al., 2011).

  As alterações na sinalização do óxido nítrico para regular o fluxo de saída do humor aquoso e a autoregulação do fluxo sangüíneo na retina estão implicadas no glaucoma primário de ângulo aberto (GPAA). A ingestão de ON pode ser um alvo terapêutico do GPAA e uma fonte exógena é o nitrato na dieta. Assim Wiggs e colaboradores (2017) avaliaram a associação entre o consumo de nitrato na dieta, derivado principalmente de vegetais de folhas verdes e o GPAA. Fizeram um estudo prospectivos com 63.893 mulheres (1984-2012) e 41.094 homens (1986-2012) com idade acima de 40 anos. A ingestão de nitrato foi documentada através de questionários específicos e exames oftalmológicos completos para detectar glaucoma. A ingestão mais alta de nitrato através do consumo de vegetais de folhas verdes foi associada a um risco de glaucoma menor e particularmente a um menor risco de GPAA com perda precoce de camadas de fibras nervosas paracentral no momento do diagnóstico (WIGGS; PASQUALE, 2017).

  Corticosteróides tópicos, os fármacos mais úteis para tratar doenças inflamatórias oculares, podem aumentar a PIO por impedir o fluxo de saida do humor aquoso; portanto, seu uso é limitado em pacientes com glaucoma (GONZALEZ et al., 2010). Assim foi realizado um estudo com modelo experimental para obter informações sobre o papel do óxido nítrico no glaucoma e comparar dexametasona liberadora de óxido nítrico com fosfato de dexametasona isolada. Seis coelhos foram tratados com fosfato de dexametasona 0,1% no olho direito e com dexametasona liberadora de óxido nítrico no olho esquerdo durante 5 semanas. Os parâmetros considerados foram PIO, níveis de óxido nítrico humor aquoso, hemodinâmica da artéria oftálmica (por meio de imagens Doppler coloridas), expressão da sintetase óxido nítrico endotelial (eNOS) nos processos ciliares e histologia de corpos ciliares. O resultado do estudo foi que a dexametasona isolada aumentou os níveis da PIO e a dexametasona liberadora de óxido nítrico não, nitrito e a enzima guanilato ciclase no humor aquoso foram reduzidos pela dexametasona isolada e aumentados com a dexametasona liberadora de óxido nítrico. Além disto o índice de resistência da artéria oftálmica foi aumentado, a expressão de eNOS foi reduzida e o corpo ciliar apresentava com lesões histológicas nos olhos tratados com dexametasona isolada quando comparados com os olhos tratados com dexametasona liberadora de óxido nítrico. Assim a dexametasona liberadora de óxido nítrico pode evitar o aumento da PIO, comprometimento do fluxo sangüíneo ocular e alterações morfológicas nos corpos ciliares induzidas pelo tratamento com corticosteróides (GALASSI et al., 2006).

  A pressão intraocular elevada (PIO) é o principal fator de risco para glaucoma. A administração de óxido nítrico (ON) exógeno diminui a PIO ao aumentar o fluxo de saída do humor aquoso através do trabeculado, mas se a produção endógena de ON contribui para a regulação fisiológica do fluxo de saída do humor aquoso ainda não esta clara. Facilitação no fluxo de saída foi medida por perfusão controlada por pressão em olhos enucleados de camundongos selvagem C57BL/6 (WT) e camundongos transgênicos (eNOS-PFVtr) que expressam eNOS humana fundida com a proteína fluorescente verde (eNOS PFV) sobreposta a expressão endógena da eNOS. Em camundongos WT, o ON exógeno fornecido por 100 μM

  S-nitroso-N acetilpenicilamina (SNAP) aumentou fluxo de saída do humor aquoso em 62% em relação aos olhos controles perfundidos com o SNAP inativo (NAP) (p=0,016). Em contraste, nos olhos de camundongos eNOS-PFVtr o SNAP não teve efeito em relação ao NAP (p=0,40). Em camundongos WT, o inibidor de NOS não seletivo ester-metil-N-nitro-L-arginina (L- NAME, 10 μM)) diminuiu o fluxo de saída do humor aquoso em 36% (p=0,012), mas 100 μM de L-NAME não teve efeito detectável no fluxo de saída (p=0,22). Um inibidor seletivo de eNOS (cavtratina,50 μM) diminuiu fluxo de saída do humor aquoso em 19% no WT (p=0,011) e 39% em camundongos eNOS-PFVtr (p=0,014). Na via de saída convencional do humor aquoso em camundongos eNOS-PFVtr, a expressão da eNOS PFV foi localizada em células endoteliais que revestem o canal de Schlemm e em vasos sanguineos por onde passa o fluxo de saída do humor aquoso , sem qualquer expressão aparente na rede trabecular. Estes resultados sugerem que a produção do óxido nítrico endógeno pela eNOS dentro das células endoteliais do canal de Schlemm ou em vasos sanguineos por onde passa o fluxo de saída do humor aquoso contribui para a regulação fisiológica do fluxo de saída do humor aquoso em camundongos, representando uma estratégia viável para diminuir com mais sucesso a PIO de pacientes com glaucoma (CHANG et al., 2015).

  Além disto o polimorfismo G894T da eNOS tem sido associado com outras doenças como por exemplo: doença coronariana, hipertensão arterial, infarto do miocárdio, isquemia cerebral, enxaqueca, doenças renais, Alzheimer, neuropatia óptica isquêmica anterior, doença periodontal e pré-eclâmpsia. Veja tabela 21.

  Tabela 21: Associação do polimorfismo G894T da eNOS e o desenvolvimento de doenças

  Doenças Referência Doença coronariana (CASAS et al., 2004; NASSAR et al., 2001; STANKEVICIUS et al.,

  2003; TIAN et al., 2013) Hipertensão arterial (CASAS et al., 2004; G. et al., 2001; JÁCHYMOVÁ et al., 2001;

  KARVONEN et al., 2002; WANG; WANG, 2000) Infarto do miocárdio (CASAS et al., 2004; JÁCHYMOVÁ et al., 2001; KARVONEN et al., 2002;

  LEESON et al., 2002; TIAN et al., 2013) Isquemia cerebral (ELBAZ et al., 2000) Enxaqueca (BORRONI et al., 2006) Doenças renais (NOIRI et al., 2002; SHIN SHIN et al., 2004) Alzheimer (AKOMOLAFE et al., 2006) Neuropatia óptica (T. SAKAI, et al, 2007) isquêmica anterior Doença periodontal (BERDELI et al., 2006) Pré-eclâmpsia (LUIZON et al., 2009; SAVVIDOU et al., 2001; YU et al., 2006)

  Nosso estudo apresenta limitações devido amostra ser pequena e não consideramos outros fatores de risco de glaucoma (Ex: miopia, doenças sistêmicas e outros genes). Grandes estudos com tamanho de amostras grandes e que levem em consideração outros fatores de risco de glaucoma necessitam ser realizados para estabelecer a associação ente eNOS e GPAA.

6. CONCLUSÃO:

   Neste estudo nós não observamos associação entre o polimorfismo G894T do gene eNOS com glaucoma primário de ângulo aberto.  Não houve nenhuma associação entre polimorfismo G894T do gene eNOS com glaucoma primário de ângulo aberto após estratificação por gênero, diabetes, hipertensão arterial sistêmica e etnia.

7. REFERÊNCIAS BIBLIOGRÁFICAS:

  AKOMOLAFE, A. et al. Genetic association between endothelial nitric oxide synthase and Alzheimer disease. Clinical Genetics, v. 70, n. 1, p. 49 –56, 2006.

  ALLEN, J. B.; KENG, T.; PRIVALLE, C. Nitric oxide and peroxynitrite production in ocular inflammation. Environmental Health Perspectives, v. 106, n. SUPPL. 5, p. 1145

  • –1149, 1998. ARGUS, W. A. Ocular hypertension and central corneal thickness. Ophthalmology, v. 102, n. 12, p. 1810 –1812, 1995.

  BALLIGAND, J. L. et al. Control of cardiac muscle cell function by an endogenous nitric oxide signaling system. Proceedings of the National Academy of Sciences of the United

  States of America, v. 90, n. 1, p. 347 –51, 1993.

  BAYER, A U.; FERRARI, F. Severe progression of glaucomatous optic neuropathy in patients with Alzheimer’s disease. Eye (London, England), v. 16, n. 2, p. 209–12, 2002. BECQUET, F.; COURTOIS, Y.; GOUREAU, O. Nitric oxide in the eye: Multifaceted roles and diverse outcomes. Survey of Ophthalmology, v. 42, n. 1, p. 71

  • –82, 1997. BEHAR-COHEN, F. F. et al. Decreased intraocular pressure induced by nitric oxide donors is correlated to nitrite production in the rabbit eye. Investigative Ophthalmology and Visual

  Science, v. 37, n. 8, p. 1711 –1712, 1996.

  BERDELI, A. et al. Endothelial nitric oxide synthase Glu298Asp gene polymorphism in periodontal diseases. Journal of periodontology, v. 77, n. 8, p. 1348

  • –54, 2006. Biblioteca virtual em saúde. Disponível em:http://www.hosb.com.br/especial/glaucoma002.jpg Acesso em: 10/03/2017. BONFOCO, E. et al. Apoptosis and necrosis: two distinct events induced, respectively, by mild and intense insults with N-methyl-D-aspartate or nitric oxide/superoxide in cortical cell cultures. Proceedings of the National Academy of Sciences of the United States of America, v. 92, n. 16, p. 7162 –6, 1995. BORRONI, B. et al. Endothelial nitric oxide synthase (Glu298Asp) polymorphism is an independent risk factor for migraine with aura. Headache, v. 46, n. 10, p. 1575 –1579, 2006.

  BRÜNE, B.; VON KNETHEN, A; SANDAU, K. B. Nitric oxide and its role in apoptosis.

  European journal of pharmacology, v. 351, n. 3, p. 261 –272, 1998.

  CAPRIOLI, J.; COLEMAN, A. L. Intraocular Pressure Fluctuation. A Risk Factor for Visual Field Progression at Low Intraocular Pressures in the Advanced Glaucoma Intervention Study. Ophthalmology, v. 115, n. 7, 2008.

  CASAS, J. P. et al. Endothelial Nitric Oxide Synthase Genotype and Ischemic. Circulation., v. 109, p. 1359 –1365, 2004.

  CAVET, M. E. et al. Nitric Oxide (NO): An Emerging Target for the Treatment of Glaucoma.

  Investigative Ophthalmology & Visual Science, v. 55, n. 8, p. 5005 –5015, 2014.

  CHANG, J. Y. H. et al. Role of nitric oxide in murine conventional outflow physiology.

  American Journal of Physiology - Cell Physiology, v. 309, n. 4, p. C205 –C214, 2015.

  CHANG, T. C. et al. Determinants and heritability of intraocular pressure and cup-to-disc ratio in a defined older population. Ophthalmology, v. 112, n. 7, p. 1186

  • –1191, 2005. CHIOTOROIU, S. et al. The importance of alcohol abuse and smoking in the evolution of glaucoma disease. Journal of medicine and life, v. 6, n. 2, p. 226 –229, 2013.

  CHUMBLEY, L. C.; BRUBAKER, R. F. Low-Tension Glaucoma. American Journal of Ophthalmology, v. 81, n. 6, p. 761 –767, 1976. COHEN, R. A. The role of nitric oxide and other endothelium-derived vasoactive substances in vascular disease. Progress in Cardiovascular Diseases, v. 38, n. 2, p. 105

  • –128, 1995. DEMIRYUREK, A. T.; CAKICI, I.; KANZIK, I. Peroxynitrite: A putative cytotoxin.

  Pharmacology and Toxicology, v. 82, n. 3, p. 113 –117, 1998.

  DEOVER, T.; EYE, D. Intraocular Pressure in an American Community. Investigative Ophthalmology, v. 33, n. 7, p. 2224 –2228, 1992. DIMASI, D. P.; BURDON, K. P.; CRAIG, J. E. The genetics of central corneal thickness.

  The British journal of ophthalmology, v. 94, n. 8, p. 971 –976, 2010.

  DOUCETTE, L. P. et al. The interactions of genes, age, and environment in glaucoma pathogenesisSurvey of Ophthalmology, 2015a. DOUCETTE, L. P. et al. The interactions of genes, age, and environment in glaucoma pathogenesis. Survey of Ophthalmology, v. 60, n. 4, p. 310

  • –326, 2015b. ELBAZ, A. et al. Association between the Glu298Asp polymorphism in the endothelial constitutive nitric oxide synthase gene and brain infarction. The GENIC Investigators.

  Stroke; a journal of cerebral circulation, v. 31, n. 7, p. 1634 –1639, 2000.

  EMAM, W. A. et al. Endothelial nitric oxide synthase polymorphisms and susceptibility to high-tension primary open-angle glaucoma in an Egyptian cohort. n. April, p. 804

  • –811, 2014. EUROPE PMC FUNDERS GROUP. Genome-wide analysis of multiethnic cohorts identifies new loci influencing intraocular pressure and susceptibility to glaucoma. Nat Genetics, n. 46, p. 1126 –1130, 2014.

  FAUTSCH, M. P. et al. Aqueous humor outflow: What do we know? Where will it lead us?

  Investigative Ophthalmology and Visual Science, v. 47, n. 10, p. 4181 –4187, 2006.

  G., L. et al. A common variant of endothelial nitric oxide synthase (Glu298Asp) is an independent risk factor for carotid atherosclerosis. Stroke, v. 32, n. 3, p. 740, 2001. GAASTERLAND, D. E. et al. Common variants near ABCA1, AFAP1 and GMDS confer risk of primary open-angle glaucoma. Nat Genet., v. 10, n. 46, p. 1120

  • –1125, 2014. GALASSI, F. et al. A topical nitric oxide-releasing dexamethasone derivative: effects on intraocular pressure and ocular haemodynamics in a rabbit glaucoma model. The British

  journal of ophthalmology, v. 90, n. 11, p. 1414 –9, 2006.

  GAO, X. et al. A genome-wide association study of central corneal thickness in Latinos.

  Investigative ophthalmology & visual science, v. 54, n. 4, p. 2435 –43, 2013.

  GARCIA-VALENZUELA, E. et al. Programmed cell death of retinal ganglion cells during experimental glaucoma. Experimental Eye Research, v. 61, n. 1, p. 33

  • –44, 1995.
GARWAY-HEATH, D. F. et al. Vertical cup/disc ratio in relation to optic disc size: its value in the assessment of the glaucoma suspect. The British Journal of Ophthalmology, v. 82, p. 1118 –1124, 1998. GOLDSTEIN, I. M.; OSTWALD, P.; ROTH, S. Nitric oxide: A review of its role in retinal function and disease. Vision Research, v. 36, n. 18, p. 2979

  • –2994, 1996. GOLSER R et al. Functional characterization of Glu298Asp mutant human endothelial nitric oxide synthase purified from a yeast expression system. Nitric Oxide, n. 8, p. 7 –14, 2003.

  GONZALEZ, A. V et al. Risk of glaucoma in elderly patients treated with inhaled corticosteroids for chronic airflow obstruction. Pulmonary pharmacology & therapeutics, v. 23, n. 2, p. 65 –70, 2010. HAEFLIGEF, I. O.; ANDERSON, D. R. Oxygen modulation of guanylate cyclase-mediated retinal pericyte relaxations with 3-morpholino-sydnonimine and atrial natriuretic peptide.

  Investigative Ophthalmology and Visual Science, v. 38, n. 8, p. 1563 –1568, 1997.

  HAEFLIGER, F. O.; ZSCHAUER, A.; ANDERSON, D. R. Relaxation of retinal pericyte contractile tone through the nitric oxide- cyclic guanosine monophosphate pathway.

  Investigative Ophthalmology and Visual Science, v. 35, n. 3, p. 991 –997, 1994.

  HAEFLIGER, I. O. et al. The vascular endothelium as a regulator of the ocular circulation: A new concept in ophthalmology? Survey of Ophthalmology, v. 39, n. 2, p. 123

  • –132, 1994. HAEFLIGER, I. O. et al. Potential role of nitric oxide and endothelin in the pathogenesis

  of glaucomaSurvey of Ophthalmology. Anais...1999

  HAEFLIGER, I. O.; FLAMMER, J.; LUSCHER, T. F. Nitric oxide and endothelin-1 are important regulators of human ophthalmic artery. Investigative Ophthalmology and Visual

  Science, v. 33, n. 7, p. 2340 –2343, 1992.

  HAEFLIGER, I. O.; FLAMMER, J.; LUSCHER, T. F. Heterogeneity of endothelium- dependent regulation in ophthalmic and ciliary arteries. Investigative Ophthalmology and

  Visual Science, v. 34, n. 5, p. 1722 –1730, 1993.

  HAYREH, S. S. et al. Nocturnal arterial hypotension and its role in optic nerve head and ocular ischemic disorders. American journal of ophthalmology, v. 117, n. 5, p. 603

  • –24, 1994. HERNANDEZ, M. R. The optic nerve head in glaucoma: Role of astrocytes in tissue remodeling. Progress in Retinal and Eye Research, v. 19, n. 3, p. 297 –321, 2000.

  HINGORANI, A. D. et al. A Common Variant of the Endothelial Nitric Oxide Synthase (Glu2983Asp) Is a Major Risk Factor for Coronary Artery Disease in the UK. Circulation, n. 100, p. 1515 –1521, 1999. HOGG, N.; KALYANARAMAN, B. Nitric Oxide and Lipid Peroxidation. Biochimica et Biophysica Acta (BBA) - Bioenergetics, v. 1411, n. 2 –3, p. 378–384, 1999.

  HOWELL, G. R. et al. Intrinsic axonal degeneration pathways are critical for glaucomatous damage. Experimental Neurology, v. 246, p. 54

  • –61, 2013.

  ITO, Y. A.; WALTER, M. A. Genomics and anterior segment dysgenesis: A review. Clinical

  and Experimental Ophthalmology, v. 42, n. 1, p. 13 –24, 2014.

  JÁCHYMOVÁ, M. et al. Association of the Glu298Asp polymorphism in the endothelial nitric oxide synthase gene with essential hypertension resistant to conventional therapy.

  Biochemical and biophysical research communications, v. 284, n. 2, p. 426 –30, 2001.

  JINDAL, V. Glaucoma: An extension of various chronic neurodegenerative disorders.

  Molecular Neurobiology, v. 48, n. 1, p. 186 –189, 2013.

  KANG, J. H. et al. Endothelial nitric oxide synthase gene variants and primary open-angle glaucoma: interactions with hypertension, alcohol intake, and cigarette smoking. Archives of

  ophthalmology, v. 6, n. 129, p. 773 –780, 2011.

  KARANTZOULIS-FEGARAS, F. et al. Characterization of the human endothelial nitric- oxide synthase promoter. The Journal of biological chemistry, v. 274, n. 5, p. 3076

  • –3093, 1999. KARVONEN, J. et al. Endothelial nitric oxide synthase gene Glu298Asp polymorphism and blood pressure, left ventricular mass and carotid artery atherosclerosis in a population-based cohort. Journal of Internal Medicine, v. 251, n. 2, p. 102 –110, 2002.

  KASHII, S. et al. Dual actions of nitric oxide in N-methyl-D-aspartate receptor-mediated neurotoxicity in cultured retinal neurons. Brain Research, v. 711, n. 1

  • –2, p. 93–101, 1996. KHOR, C. C. et al. Genome-wide association studies in Asians confirm the involvement of ATOH7 and TGFBR3, and further identify CARD10 as a novel locus influencing optic discarea. Human Molecular Genetics, v. 20, n. 9, p. 1864 –1872, 2011.

  KLEIN, B. E.; KLEIN, R.; LEE, K. E. Heritability of risk factors for primary open-angle glaucoma: the Beaver Dam Eye Study. Invest Ophthalmol Vis Sci, v. 45, n. 1, p. 59

  • –62, 2004. KOSIOR-JARECKA, E. et al. Risk Factors for Normal and High-Tension Glaucoma in Poland in Connection with Polymorphisms of the Endothelial Nitric Oxide Synthase Gene.

  PloS one, v. 11, n. 1, p. e0147540, 2016.

  LEESON, C. P. M. et al. Glu298Asp endothelial nitric oxide synthase gene polymorphism interacts with environmental and dietary factors to influence endothelial function. Circulation

  Research, v. 90, n. 11, p. 1153 –1158, 2002.

  LEVENE, R. Low tension glaucoma: a critical review and new material. Survey of

  Ophthalmology, v. 24, n. 6, p. 621 –664, 1980.

  LIAO, Q.; WANG, D.-H.; SUN, H.-J. Association of genetic polymorphisms of eNOS with glaucoma. Molecular vision, v. 17, n. January, p. 153

  • –158, 2011. LO, H.-C. et al. The Nitric Oxide Synthase Inhibitor NG-Nitro-L-Arginine Methyl Ester Diminishes the Immunomodulatory Effects of Parental Arginine in Rats with Subacute Peritonitis. Plos One, v. 11, n. 3, p. e0151973, 2016. LOGAN, J. F. J. et al. Evidence for association of endothelial nitric oxide synthase gene in subjects with glaucoma and a history of migraine. Investigative Ophthalmology and Visual Science, v. 46, n. 9, p. 3221 –3226, 2005. LÓPEZ-FARRÉ, A. et al. Role of nitric oxide in the control of apoptosis in the microvasculature. International Journal of Biochemistry and Cell Biology, v. 30, n. 10, p. 1095 –1106, 1998.

  LU, Y. et al. Common genetic variants near the brittle cornea syndrome locus ZNF469 influence the blinding disease risk factor central corneal thickness. PLoS Genetics, v. 6, n. 5, p. 23, 2010. LU Y; VITART, V.; BURDON, K. P. Genome-wide association analyses identify multiple loci associated with central corneal thickness and keratoconus. Nat Genet., n. 45, p. 155

  • –163, 2013. LUIZON, M. R. et al. Endothelial nitric oxide synthase polymorphisms and haplotypes in Amerindians. DNA and cell biology, v. 28, n. 7, p. 329 –334, 2009.

  MACGREGOR, S. et al. Genome-wide association identifies ATOH7 as a major gene determining human optic disc size. Human Molecular Genetics, v. 19, n. 13, p. 2716

  • –2724, 2010. MAGALHAES DA SILVA, T. et al. Association of polymorphisms of endothelial nitric oxide synthase (eNOS) gene with the risk of primary open angle glaucoma in a Brazilian population. Gene, n. 502, p. 142 –146, 2012.

  MANN, R. M. et al. Nitric Oxide and Choroidal Blood Flow Regulation. v. 36, n. 5, 1995. MARSDEN P.A. Structure and chromosomal localization of the human constitutive

  • – endothelial nitric oxide synthase gene. Journal of Biological Chemistry, n. 268, p. 17478 17488, 1993. MCKINNON, S. J. The cell and molecular biology of glaucoma: Common neurodegenerative pathways and relevance to glaucoma. Investigative Ophthalmology and Visual Science, v. 53, n. 5, p. 2485 –2487, 2012.

  MEHRTASHFAR, S.; SCIENCES, M. ASSOCIATION OF ENOS 894 G > T GENE POLYMORPHISM AND RISK OF CORONARY ARTERY DISEASE IN IRANIAN POPULATION. INTERNATIONAL JOURNAL OF BASIC- BIOSCIENCES, v. 2, n. 1, p. 27 –30, 2014.

  MURPHY, M. P. et al. Peroxynitrite: A biologically significant oxidant. General Pharmacology, v. 31, n. 2, p. 179 –186, 1998. NASSAR, B. A. et al. Relationship of the Glu298Asp polymorphism of the endothelial nitric oxide synthase gene and early-onset coronary artery disease. American Heart Journal, v. 142, n. 4, p. 586 –589, 2001. NEUFELD, A.; HERNANDEZ, M. R.; GONZALEZ, M. Nitric oxide synthase in the human glaucomatous optic nerve head. Arch.Ophthalmol., n. 115, p. 497

  • –503, 1997. NOIRI, E. et al. Association of eNOS Glu298Asp polymorphism with end-stage renal disease.

  Hypertension, v. 40, n. 4, p. 535 –540, 2002.

  NOMURA, H. et al. Age-related changes in intraocular pressure in a large Japanese

  • – population: a cross-sectional and longitudinal study. Ophthalmology, v. 106, n. 10, p. 2016 2022, 1999. OSBORNE, N. N. et al. A hypothesis to explain ganglion cell death caused by vascular insults at the optic nerve head: possible implication for the treatment of glaucoma. The

  British journal of ophthalmology, v. 85, n. 10, p. 1252 –9, 2001.

  OZEL, A. B. et al. Genome-wide association study and meta-analysis of intraocular pressure.

  Human Genetics, v. 133, n. 1, p. 41 –57, 2014.

  PICKKERS, P. et al. In vivo evidence for nitric oxide-mediated calcium-activated potassium- channel activation during human endotoxemia. Circulation, v. 114, n. 5, p. 414

  • –421, 2006. QUIGLEY, H. A et al. Retinal Ganglion Cell Death in Experimental Glaucoma and After Axotomy Occurs by Apoptosis. Investigative Ophthalmology, v. 36, n. April, p. 774
  • –86, 1995. QUIGLEY, H. A. Number of people with glaucoma worldwide. British Journal of Ophthalmology, v. 90, p. 262 –267, 2006a. QUIGLEY, H. A. Number of people with glaucoma worldwide in 2010 and 2020. British

  Journal of Ophthalmology, v. 890, n. 5, p. 262 –267, 2006b.

  QUIGLEY, H.; DUNKELBERGER, GR.; GREEN, W. Chronic Human Glaucoma Causing

  • – Selectively Greater Loss of Large Optic Nerve Fibers. Ophthalmology, v. 95, n. 3, p. 357 363, 1988. RAMDAS, W. D. et al. A genome-wide association study of optic disc parameters. PLoS

  Genetics, v. 6, n. 6, p. 1 –12, 2010.

  RAYMOND, V. Molecular genetics of the glaucomas: mapping of the first five “GLC” loci.

  American journal of human genetics, v. 60, n. 2, p. 272 –7, 1997.

  RESCH, Z. T.; FAUTSCH, M. P. Glaucoma-associated myocilin: A better understanding but much more to learn. Experimental Eye Research, v. 88, p. 704

  • –712, 2009. RICHTER, C. Nitric oxide and its congeners in mitochondria: Implications for apoptosis.

  Environmental Health Perspectives, v. 106, n. SUPPL. 5, p. 1125 –1130, 1998.

  ROCHTCHINA, E.; MITCHELL, P.; WANG, J. J. Relationship between age and intraocular pressure: the Blue Mountains Eye Study. Clinical & experimental ophthalmology, v. 30, n. 3, p. 173 –175, 2002. RUDNICKA, A. R. et al. Variations in primary open-angle glaucoma prevalence by age, gender, and race: A Bayesian meta-analysis. Investigative Ophthalmology and Visual

  Science, v. 47, n. 10, p. 4254 –4261, 2006.

  SAVVIDOU, M. D. et al. Maternal Vascular Adaptation to Pregnancy. Hypertension., n. 38, p. 1289 –1293, 2001.

  SCHEETZ, T. E. et al. A Genome-Wide Association Study for Primary Open Angle Glaucoma and Macular Degeneration Reveals Novel Loci. PLoS ONE, v. 8, n. 3, p. 25

  • –30, 2013. SHAH, S. et al. Relationship between corneal thickness and measured intraocular pressure in a general ophthalmology clinic. Ophthalmology, v. 106, p. 2154 –2160, 1999.

  SHIN SHIN, Y. et al. Relations between eNOS Glu298Asp polymorphism and progression of diabetic nephropathy. Diabetes Research and Clinical Practice, v. 65, n. 3, p. 257

  • –265, 2004. STANKEVICIUS, E. et al. Role of nitric oxide and other endothelium-derived factors.

  Medicina (Kaunas, Lithuania), v. 39, n. 4, p. 333 –341, 2003.

  T. SAKAI, K. SHIKISHIMA, M. MATSUSHIMA, AND K. K. Endothelial nitric oxide synthase gene polymorphisms in nonarteritic anterior ischemic optic neuropathy. Clinical

  and Experimental Ophthalmology, v. 245, n. 2, p. 288 –292, 2007.

  TAJEHMIRI, A. et al. Association of the G894T polymorphism of the endothelial nitric oxide synthase gene with migraine: an Iranian case-control study.

  Journal of Biology and today’s world, v. 2, n. 9, p. 417 –424, 2016.

  TAMURA, H. et al. High frequency of open-angle glaucoma in Japanese patients with Alzheimer’s disease. Journal of the Neurological Sciences, v. 246, n. 1–2, p. 79–83, 2006. THAM, Y. C. et al. Global prevalence of glaucoma and projections of glaucoma burden through 2040: A systematic review and meta-analysis. Ophthalmology, v. 121, n. 11, p. 2081 –2090, 2014. THOMAS, D. D. et al. The chemical biology of nitric oxide. Implications in celular signaling.

  Free Radical Biology and Medicine, v. 45, n. 1, p. 18 –31, 2008.

  TIAN, G.-X. et al. Association between the endothelial nitric oxide synthase gene Glu298Asp polymorphism and coronary heart disease: A meta-analysis of 39 case-control studies.

  Molecular Medicine Reports, v. 7, n. 5, p. 1310 –1318, 2013.

  TOH, T. et al. Central corneal thickness is highly heritable: The twin eye studies.

  Investigative Ophthalmology and Visual Science, v. 46, n. 10, p. 3718 –3722, 2005.

  TSAI, W. C. et al. Nitric oxide is required for effective innate immunity against Klebsiella pneumoniae . Nitric Oxide Is Required for Effective Innate Immunity against Klebsiella pneumoniae. Infect Immun, v. 65, n. 5, p. 1870 –1875, 1997.

  VAN KOOLWIJK, L. M. E. et al. Genetic contributions to glaucoma: Heritability of intraocular pressure, retinal nerve fiber layer thickness, and optic disc morphology.

  Investigative Ophthalmology and Visual Science, v. 48, n. 8, p. 3669 –3676, 2007.

  VAN KOOLWIJK, L. M. E. et al. Common genetic determinants of intraocular pressure and primary open-angle Glaucoma. PLoS Genetics, v. 8, n. 5, p. e1002611, 2012.

  VITART, V. et al. New loci associated with central cornea thickness include COL5A1, AKAP13 and AVGR8. Human Molecular Genetics, v. 19, n. 21, p. 4304 –4311, 2010.

  VITHANA, E. N. et al. Collagen-related genes influence the glaucoma risk factor, central corneal thickness. Human Molecular Genetics, v. 20, n. 4, p. 649

  • –658, 2011.

  VOET, D.; VOET, J. Biochemical communications: hormones and neurotransmitters, in Biochemistry. 2. ed. New York: [s.n.].

  VORWERK, C. K. et al. The role of neuronal and endothelial nitric oxide synthase in retinal excitotoxicity. Invest Ophthalmol Vis Sci, v. 38, n. 10, p. 2038

  • –44., 1997. WANG, X. L.; WANG, J. Endothelial nitric oxide synthase gene sequence variations and vascular disease. Molecular genetics and metabolism, v. 70, n. 4, p. 241 –51, 2000.

  WEIH, L. M. et al. Association of demographic, familial, medical, and ocular factors with intraocular pressure. Archives of ophthalmology, v. 119, n. 6, p. 875

  • –880, 2001. WHITACRE, M.; STEIN, R.; HASSANEIN, K. The effect of corneal thickness on applanation tonometry.

  American journal of …, v. 115, n. 5, p. 592–596, 1993.

  WIGGS, J. L. et al. Common variants near CAV1 and CAV2 are associated with primary open-angle glaucoma in Caucasians from the USA. Human Molecular Genetics, v. 20, n. 23, p. 4707 –4713, 2011.

  WIGGS, J. L. The cell and molecular biology of complex forms of glaucoma: Updates on genetic, environmental, and epigenetic risk factors. Investigative Ophthalmology and

  Visual Science, v. 53, n. 5, p. 2467 –2469, 2012.

  WIGGS, J. L.; PASQUALE, L. R. HHS Public Access. v. 134, n. 3, p. 294 –303, 2017. WONG, T. T. et al. The relationship of intraocular pressure with age, systolic blood pressure, and central corneal thickness in an asian population. Investigative ophthalmology & visual

  science, v. 50, n. 9, p. 4097 –4102, 2009.

  WOSTYN, P.; AUDENAERT, K.; DE DEYN, P. P. Alz heimer’s disease and glaucoma: is there a causal relationship? The British Journal of Ophthalmology, v. 93, n. 12, p. 1557

  • –9, 2009. YU, C. K. H. et al. Endothelial nitric oxide synthase gene polymorphism (Glu298Asp) and development of pre-eclampsia: a case-control study and a meta-analysis. BMC pregnancy and childbirth, v. 6, p. 7, 2006.

  APÊNDICE I

  PRố-REITORIA DE PốS-GRADUAđấO E PESQUISA COMITÊ DE ÉTICA EM PESQUISA CONSENTIMENTO DA PARTICIPAđấO DA PESSOA COMO SUJEITO

  TERMO DE CONSENTIMENTO LIVRE E ESCLARECIDO-GRUPO CASO

  Você está sendo convidado (a) para participar, como voluntário (a), do Projeto de Pesquisa sob o tắtulo ASSOCIAđấO DO POLIMORFISMO G894T DO GENE eNOS COM

  GLAUCOMA PRIMÁRIO DE ÂNGULO ABERTO.

  Meu nome é___________, sou pesquisador (a) responsável pelo projeto. As informações e esclarecimentos a respeito da pesquisa serão repassados e caso aceite participar do estudo, este documento deverá ser assinado em duas vias. A primeira será de guarda e confidencialidade do pesquisador (a) responsável e a segunda ficará sob sua responsabilidade para quaisquer fins. Você pode se recusar a participar ou se retirar deste estudo a qualquer momento, sem sofrer nenhum tipo de penalização. Qualquer dúvida sobre a pesquisa, você poderá entrar em contato com a coordenadora responsável Dra. Katia Karina Verolla de Oliveira Moura no telefone: 62-3946-1385 ou através do e-mail kkverolli@pucgoias.edu.br. Em caso de dúvida sobre a ética aplicada a pesquisa, você poderá entrar em contato com o Comitê de Ética em Pesquisa da Pontifícia Universidade Católica de Goiás, telefone: (62) 3946-1512.

  I. O paciente que estará sob consulta e com o diagnóstico de glaucoma (pressão alta nos olhos) será contatado e informado da pesquisa. Caso aceite deverá assinar o TCLE e caso se recuse ou desista em qualquer momento da pesquisa o seu atendimento terá continuidade normal.

  II. A pesquisa consiste na análise laboratorial de amostras de sangue para detecção da variação das doenças genéticas de cada paciente que possam estar relacionadas ao glaucoma.

  III. O objetivo da pesquisa é a detecção da variação das doenças genéticas de cada indivíduo bem como a detecção de pacientes com alto risco de desenvolver a doença.

  IV. As amostras de sangue coletadas serão analisadas para verificar a presença das variações de cada paciente. Os critérios de inclusão são: histórias clinicas completa, avaliação da relação escavação/disco (E/D) sob midríase, do campo visual (Humphry Field Analyzer), paquimetria (Echoscan US-400), pressão intraocular (tonômetro de aplanação) e gonioscopia. E para descartar outras doenças oculares, os pacientes também seram submetidos a exame de lâmpada de fenda, motilidade ocular, mapeamento de retina e acuidade visual. Os pacientes com glaucoma seram brasileiros, com idade acima de 40 anos, ângulo da câmara anterior aberto (identificação do corpo ciliar nos quatro quadrantes), PIO maior que 21 mmHg antes do início do tratamento e alterações de nervo optico e campo visual compatível com dano glaucomatoso. Exclusão de pacientes com outras formas de glaucoma (congênito, pigmentado, pseudoexfoliativo, pós uveíte, pós trauma, induzido por corticoide, etc), hipertenso ocular (PIO acima de 21 com nervo optico e campo visual normal) e glaucoma de início antes dos 40 anos.

  V. Nenhuma pesquisa com seres humanos é livre de riscos. Os procedimentos envolvidos no presente estudo oferecem riscos aos participantes e estão relacionados a acidentes biológicos e/ou complicações no local da coleta que poderá ficar dolorido, avermelhado ou arroxeado. Caso ocorra qualquer tipo de dano à saúde e à integridade física e/ou psicológica do paciente em decorrência dos procedimentos da pesquisa, este terá atendimento integral e irrestrito garantido pelo pesquisador responsável.

  VI. Os resultados da pesquisa serão enviados para você e permanecerão confidenciais. Caso o resultado seja positivo, você será informado pelo médico responsável, que já atua no diagnóstico e tratamento dos pacientes com glaucoma. Seu nome ou o material que indique a sua participação não será liberado sem a sua permissão e você não será identificado (a) em nenhuma publicação que possa resultar deste estudo.

  VII. O material será utilizado somente para fins de pesquisa, além de autorizar, pelo presente estudo, que os testes e os resultados sejam utilizados em estudos científicos, publicação de artigos, ressalvando o sigilo quanto ao seu nome, reservando o direito de conhecer ou não os resultados da referida pesquisa. O material após realização dos exames será descartado.

  VIII. É assegurada a assistência do participante durante toda pesquisa e o médico Dr. Eduardo Eustaquio de Almeida Filho continuará a dar todo o suporte para qualquer intercorrência que ocorra decorrente da coleta de sangue e durante o período da pesquisa. É garantido o livre acesso a todas as informações e esclarecimentos adicionais sobre o estudo e suas consequências. Para qualquer outra informação, o (a) Sr (a) poderá entrar em contato com o pesquisador no endereço: Rua: Couto Magalhães n: 50, Jardim da Luz, Goiânia, Goiás ou pelo telefone: (62) 3219-4100.

  IX. Está garantido o direito de retirar o consentimento a qualquer momento, sem que isto leve a qualquer penalidade ou interrupção de meu acompanhamento/assistência/tratamento. Em caso

  de recusa você não será penalizado de forma alguma sem qualquer prejuízo a sua pessoa e que será mantido o total sigilo dos resultados, que serão entregues apenas a você ou responsável.

  X. A participação na pesquisa não acarretará custos para você, assim como não será disponibilizado nenhum ressarcimento financeiro adicional.

  XI. Não está previsto indenização por sua participação, mas em qualquer momento se você sofrer algum dano, comprovadamente decorrente desta pesquisa, terá direito à indenização requerida em termos legais. Eu _______________, RG _______, abaixo assinado, discuti com o Dr. Eduardo Eustáquio de Almeida Filho, sobre a minha decisão em participar nesse estudo. Declaro ter recebido e compreendido todas as informações referentes aos propósitos do estudo, procedimentos a serem realizados, seus desconfortos e riscos, as garantias de confidencialidade e de esclarecimentos permanentes. Ficou claro também que minha participação é isenta de despesas e que tenho garantia do acesso a tratamento hospitalar quando necessário. Concordo voluntariamente em participar deste estudo e poderei retirar o meu consentimento a qualquer momento, antes ou durante o mesmo, sem penalidades ou prejuízo ou perda de qualquer benefício que eu possa ter adquirido, ou no meu atendimento neste Serviço.

  Goiânia, ___, de _____________, de 201_. _______________________________ ___/ ___/_____ Assinatura do participante Data ________________________________ ___/ ___/_____ Assinatura do responsável pelo estudo Data

  APÊNDICE II

  PRố-REITORIA DE PốS-GRADUAđấO E PESQUISA COMITÊ DE ÉTICA EM PESQUISA

  TERMO DE CONSENTIMENTO LIVRE E ESCLARECIDO-GRUPO CONTROLE

  Você está sendo convidado (a) para participar, como voluntário (a), do Projeto de Pesquisa sob o tắtulo ASSOCIAđấO DO POLIMORFISMO G894T DO GENE eNOS COM

  GLAUCOMA PRIMÁRIO DE ÂNGULO ABERTO

  Meu nome é___________, sou o pesquisador (a) responsável pelo projeto. As informações e esclarecimentos a respeito da pesquisa serão repassados e caso aceite participar do estudo, este documento deverá ser assinado em duas vias. A primeira será de guarda e confidencialidade do pesquisador (a) responsável e a segunda ficará sob sua responsabilidade para quaisquer fins. Você pode se recusar a participar ou se retirar deste estudo a qualquer momento, sem sofrer nenhum tipo de penalização. Qualquer dúvida sobre a pesquisa, você poderá entrar em contato com a coordenadora responsável Dra. Katia Karina Verolla de Oliveira Moura no telefone: 62-3946-1385 ou através do e-mail kkverolli@pucgoias.edu.br. Em caso de dúvida sobre a ética aplicada a pesquisa, você poderá entrar em contato com o Comitê de Ética em Pesquisa da Pontifícia Universidade Católica de Goiás, telefone: (62) 3946-1512.

  I. O paciente que está sob consulta sem diagnostico de glaucoma baseado em resultados de exames que procuraram o consultório médico para outros tipos de consulta, como refração, rotina oftalmológica ou outras queixas, onde foi informado da pesquisa e caso aceite assinará o TCLE-grupo controle. Caso não aceite, ou desista no meio da pesquisa o seu atendimento terá continuidade normal.

  II. A pesquisa consiste na análise laboratorial de amostras de sangue para detecção da variação das doenças genéticas de cada paciente que possam estar relacionadas ao glaucoma.

  III. O objetivo da pesquisa é a detecção da variação das doenças genéticas de cada indivíduo bem como a detecção de pacientes com alto risco de desenvolver a doença.

  IV. As amostras de sangue do grupo controle coletadas serão analisadas para verificar a ausência das variações de cada paciente. Os critérios de inclusão são: todos os controles apresentavam idade superior a 65 anos, E/D ≤ 0,5, Idade ≥ 65 anos, sem antecedentes de glaucoma e PIO ≤ 18.

  V. Nenhuma pesquisa com seres humanos é livre de riscos. Contudo, os procedimentos envolvidos no presente estudo oferecem riscos aos participantes, estando relacionados a acidentes biológicos e/ou complicações no local da coleta que poderá ficar dolorido, avermelhado ou arroxeado. Caso ocorra qualquer intercorrência o paciente receberá auxílio/assistência no momento da coleta.

  VI. Os resultados da pesquisa serão enviados para você e permanecerão confidenciais. Caso o resultado seja positivo, você será informado pelo médico responsável, que já atua no diagnóstico e tratamento dos pacientes com glaucoma. Seu nome ou o material que indique a sua participação não será liberado sem a sua permissão e você não será identificado (a) em nenhuma publicação que possa resultar deste estudo.

  VII. O material será utilizado somente para fins de pesquisa, além de autorizar, pelo presente estudo, que os testes e os resultados sejam utilizados em estudos científicos, publicação de artigos, ressalvando o sigilo quanto ao meu nome, reservando-me o direito de conhecer ou não os resultados da referida pesquisa. O material após realização dos exames será descartado.

  VIII. É assegurada a assistência do participante durante toda pesquisa e o médico Dr. Eduardo Eustáquio de Almeida Filho continuará a dar todo o suporte para qualquer intercorrência que ocorra decorrente da coleta de sangue, durante o período da pesquisa. É garantido o livre acesso a todas as informações e esclarecimentos adicionais sobre o estudo e suas consequências. Para qualquer outra informação, o (a) Sr (a) poderá entrar em contato com o pesquisador no endereço: Rua: Couto Magalhães n: 50, Jardim da Luz, Goiânia, Goiás ou pelo telefone: (62) 3219-4100.

  IX. Está garantido o direito de retirar o consentimento a qualquer momento, sem que isto leve a qualquer penalidade ou interrupção de meu acompanhamento/assistência/tratamento. Em caso de recusa você não será penalizado de forma alguma sem qualquer prejuízo a sua pessoa e que será mantido o total sigilo dos resultados, que serão entregues apenas a mim ou responsável.

  X. A participação na pesquisa não acarretará custos para você, assim como não será disponibilizado nenhum ressarcimento financeiro adicional.

  XI. Não está previsto indenização por sua participação, mas em qualquer momento se você sofrer algum dano, comprovadamente decorrente desta pesquisa, terá direito à indenização requerida em termos legais.

  Eu ____________________________________, RG ______________, abaixo assinado, discuti com o Dr. Eduardo Eustáquio de Almeida Filho, sobre a minha decisão em participar nesse estudo. Declaro ter recebido e compreendido todas as informações referentes aos propósitos do estudo, procedimentos a serem realizados, seus desconfortos e riscos, as garantias de confidencialidade e de esclarecimentos permanentes. Ficou claro também que minha participação é isenta de despesas e que tenho garantia do acesso a tratamento hospitalar quando necessário. Concordo voluntariamente em participar deste estudo e poderei retirar o meu consentimento a qualquer momento, antes ou durante o mesmo, sem penalidades ou prejuízo ou perda de qualquer benefício que eu possa ter adquirido, ou no meu atendimento neste Serviço. Goiânia, ___, de _____________, de 201_. _______________________________ ___/ ___/_____ Assinatura do participante Data ________________________________ ___/ ___/_____ Assinatura do responsável pelo estudo Data

Novo documento

Tags

Documento similar

UNIVERSIDADE FEDERAL DO CEARÁ PRÓ-REITORIA DE PESQUISA E PÓS-GRADUAÇÃO PROGRAMA DE PÓS-GRADUAÇÃO EM DESENVOLVIMENTO E MEIO AMBIENTE – PRODEMA
0
0
187
UNIVERSIDADE FEDERAL DO CEARÁ PRÓ-REITORIA DE PESQUISA E PÓS-GRADUAÇÃO PROGRAMA DE PÓS-GRADUAÇÃO EM DIREITO CURSO DE MESTRADO ACADÊMICO SILVANA PAULA MARTINS DE MELO
0
1
127
UNIVERSIDADE FEDERAL DO CEARÁ PRÓ-REITORIA DE PESQUISA E PÓS-GRADUÇÃO PROGRAMA DE PÓS-GRADUAÇÃO EM DESENVOLVIMENTO E MEIO AMBIENTE
0
0
132
PRÓ-REITORIA DE PÓS-GRADUAÇÃO E PESQUISA PROGRAMA DE PÓS-GRADUAÇÃO EM BIOTECNOLOGIA
0
0
100
UNIVERSIDADE FEDERAL DE MATO GROSSO DO SUL PRÓ-REITORIA DE PESQUISA E PÓS-GRADUAÇÃO CÂMPUS DE TRÊS LAGOAS PROGRAMA DE PÓS-GRADUAÇÃO MESTRADO EM GEOGRAFIA
0
0
252
UNIVERSIDADE FEDERAL DE MATO GROSSO DO SUL PRÓ-REITORIA DE PESQUISA E PÓS-GRADUAÇÃO CÂMPUS DE TRÊS LAGOAS PROGRAMA DE PÓS-GRADUAÇÃO MESTRADO EM GEOGRAFIA
0
0
225
UNIVERSIDADE FEDERAL DE GOIÁS PRÓ-REITORIA DE PESQUISA E PÓS-GRADUAÇÃO COORDENAÇÃO GERAL DE PESQUISA PROGRAMA INSTITUCIONAL DE BOLSAS DE INICIAÇÃO CIENTIFICA
0
0
17
UNIVERSIDADE FEDERAL DE GOIÁS PRÓ-REITORIA DE PESQUISA E PÓS-GRADUAÇÃO COORDENAÇÃO GERAL DE PESQUISA PROGRAMA INSTITUCIONAL VOLUNTÁRIO DE INICIAÇÃO CIENTIFICA
0
0
36
UNIVERSIDADE FEDERAL DE SERGIPE PRÓ-REITORIA DE PÓS-GRADUAÇÃO E PESQUISA PROGRAMA DE PÓS-GRADUAÇÃO EM COMUNICAÇÃO
0
0
183
PONTIFÍCIA UNIVERSIDADE CATÓLICA DE GOIÁS PROGRAMA DE PÓS-GRADUAÇÃO EM EDUCAÇÃO ROSÂNGELA NUNES ALMEIDA DE CASTRO
0
0
251
PONTIFÍCIA UNIVERSIDADE CATÓLICA DE GOIÁS ESCOLA DE FORMAÇÃO DE PROFESSORES E HUMANIDADES PROGRAMA DE PÓS-GRADUAÇÃO E PESQUISA EM CIÊNCIAS DA RELIGIÃO MARIA APARECIDA DE CASTRO
0
0
212
PONTIFÍCIA UNIVERSIDADE CATÓLICA DE GOIÁS DEPARTAMENTO DE PSICOLOGIA PRÓ-REITORIA DE PÓS-GRADUAÇÃO E PESQUISA PROGRAMA DE PÓS-GRADUAÇÃO STRICTO SENSU EM PSICOLOGIA
0
0
247
PONTIFÍCIA UNIVERSIDADE CATÓLICA DE GOIÁS PRÓ-REITORIA DE PÓS-GRADUAÇÃO E PESQUISA DOUTORADO EM EDUCAÇÃO ALESSANDRA DA SILVA CARRIJO
0
0
212
PONTIFÍCIA UNIVERSIDADE CATÓLICA DE GOIÁS PROGRAMA DE PÓS-GRADUAÇÃO DOUTORADO EM EDUCAÇÃO
0
0
169
PONTIFÍCIA UNIVERSIDADE CATÓLICA DE GOIÁS PRÓ-REITORIA DE PÓS-GRADUAÇÃO E PESQUISA ESCOLA DE FORMAÇÃO DE PROFESSORES E HUMANIDADES PROGRAMA DE PÓS-GRADUAÇÃO STRICTO SENSU EM CIÊNCIAS DA RELIGIÃO
0
0
223
Show more