REPOSITORIO INSTITUCIONAL DA UFOP: miRNAs em Schistosoma mansoni : biogênese, predição, validação e alvos potenciais.

Livre

0
1
230
1 year ago
Preview
Full text
(1)UNIVERSIDADE FEDERAL DE OURO PRETO INSTITUTO DE CIÊNCIAS EXATAS E BIOLÓGICAS DEPARTAMENTO DE CIÊNCIAS BIOLÓGICAS PROGRAMA DE PÓS-GRADUAÇÃO EM CIÊNCIAS BIOLÓGICAS miRNAs em Schistosoma mansoni: biogênese, predição, validação e alvos potenciais AUTOR: Msc. MATHEUS DE SOUZA GOMES ORIENTADORA: PROFa. Dra. RENATA GUERRA DE SÁ COTA CO-ORIENTADOR: PROF. PhD. CHARLES SPILLANE

(2) ________________________________________________________________________________ miRNAs em Schistosoma mansoni: biogênese, predição, validação e alvos potenciais ________________________________________________________________________________ Tese submetida ao programa de Pós-Graduação Núcleo de Pesquisa em Ciências Biológicas da Universidade Federal de Ouro Preto como parte integrante dos requisitos para obtenção do título de doutor em Ciências Biológicas, área de concentração Biologia Molecular. Autor: Msc. Matheus de Souza Gomes Orientador: Profa. Dra. Renata Guerra de Sá Cota Universidade Federal de Ouro Preto – Ouro Preto, Brasil Co-orientador: Prof. PhD. Charles Spillane National University of Ireland - Galway, Irlanda Ouro Preto - Fevereiro de 2012

(3) G631 Gomes, Matheus de Souza. miRNAs em Schistosoma mansoni [manuscrito] : biogênese, predi ção , validação e alvos potenciais / Matheus de Souza Gomes. - 2012. XIV, 201 f. il. Orientadora: Profa. Dra. Renata Guerra de Sá Cota. Orientador: Charles Spillane. Tese (Doutorado) - Universidade Federal de Ouro Preto.Instituto de Ciências Exatas e Biológicas. Núcleo de Pesquisas Biológicas em Ciên cias Biológicas. Área de concentração: Biologia molecular. 1.Schistosoma mansoni - Teses. I. Universidade Federal de Ouro Preto. II. Título. CDU: 57(43.2) Catalogação: sisbin@sisbin.ufop.br

(4)

(5) Este trabalho foi desenvolvido no Laboratório de Bioquímica e Biologia Molecular NUPEB/UFOP e Genetics and Biotechnolgy Lab, Centre for Chromosome Biology, National University of Ireland – Galway, Irlanda, com apoio financeiro da Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES) (Doutorado Sanduíche – Processo 1495-10-0) e Fundação de Amparo à Pesquisa do Estado de Minas Gerais (FAPEMIG) (CBB2935/09).

(6) Dedico esta tese aos meus pais, exemplos de vida, Luiz e Rosânia, aos meus irmãos, Marcos, Júlia e Daniela e a todos meus familiares. Dedico também ao amor de minha vida, minha esposa Carolina por me incentivar estando sempre ao meu lado. Agradeço a todos pelo apoio incondicional.

(7) Agradecimentos A Deus; Aos meus pais, Luiz e Rosânia, por serem meus exemplos de vida, humildade e persistência, sempre mostrando o caminho certo a trilhar e fazendo o bem; À minhas queridas irmãs, Daniela e Júlia, pelo apoio e amor incondicionais, sempre mostrando um ombro amigo para me acolher. Ao meu irmão Marcos pela grande amizade, amor, companheirismo e, sobretudo, por me ajudar e incentivar nos momentos mais difíceis. Aos demais familiares, pelo carinho, preocupação e por me apoiarem sempre; Ao meu amor Carol, minha esposa, pela dedicação, compreensão, auxílio e, sobretudo, por ter paciência e sabedoria, contribuindo imensuravelmente para realização deste trabalho; A minha companheirinha, Sophia “Tica”, sempre alegre e disponível para momentos de lazer e distração. À família da Carol, seus pais e sua irmã Clarissa pelo incentivo e em especial Dona Lili pela paciência e acolhimento, sendo importantes para finalização deste trabalho; À Prof.a Dr.a Renata Guerra de Sá Cota, pelos ensinamentos práticos e teóricos, pelo exemplo de dedicação, profissionalismo e sobretudo por contribuir em minha formação como pesquisador e professor. Ao professor Dr. Elio Hideo Babá, pelo exemplo de pesquisador e professor. Pelos ensinamentos na pesquisa e na vida. Por sempre se mostrar disposto a ajudar mesmo nos momentos mais difíceis. Aos professores Elísio, Leandro, Lucinha, Daniela e Karen pelo convívio agradável e aprendizado científico transmitido.

(8) Aos amigos da equipe do Laboratório de Bioquímica e Biologia Molecular (LBBM) da UFOP que passaram e se fazem presentes, muito obrigado. Em especial a Roberta que me auxiliou diretamente no trabalho. Ao Ezequiel pelo auxílio no trabalho e pelas boas risadas; A professora Liana Janotti, por gentilmente fornecer junto ao moluscário os parasitos para a realização deste trabalho. Ao moluscário do CPqRR em especial a Delza, Dilce e Sueleny pela disponibilização dos parasitos. A todos do Laboratório de Imunoparasitologia da UFOP pelo grande suporte e auxílio científico, em especial ao professor Luis Carlos Crocco por sempre se mostrar disponível para ajudar. A todos os professores do NUPEB, pela receptividade em seus Laboratórios; A todos os amigos dos laboratórios do NUPEB pela saudável convivência contribuindo para a realização deste trabalho; À Cida, secretária prestativa, atenciosa e alegre, sempre pronta para ajudar; Às seguintes instituições que colaboraram com recursos financeiros para a realização deste trabalho: CNPq e FAPEMIG. Em especial a agência CAPES pelo provimento da bolsa de estudos no Brasil e a bolsa-sanduíche na Universidade Nacional da Irlanda – Galway (Processo no 1495-10-0). À todos do laboratório de Genética e Biotecnologia da Universidade Nacional da Irlanda – Galway que contribuíram imensamente para meu aprendizado como cientista.

(9) Em especial ao Mohan Kumar Muniyappa pelas discussões e auxílio científico, a Duygu Selcuklu pelos ensinamentos transmitidos, ao Mark Donoghue pelas dicas de Bioinformática e Elyze Ema pela troca de experiências. Ao Professor Charles Spillane por me receber em seu laboratório, na Universidade Nacional da Irlanda, disponibilizando todos os recursos possíveis para meu aprendizado e crescimento como cientista. E por todos aqueles que participaram direta ou indiretamente na realização deste trabalho.

(10) “Todas as verdades são fáceis de entender, uma vez descobertas. O difícil é descobrí–las”. Galileo Galilei (1564-1642)

(11) SUMÁRIO RESUMO ........................................................................................................................... I ABSTRACT ....................................................................................................................... III LISTA DE ABREVIATURAS, SIGLAS E SÍMBOLOS .............................................. V LISTA DE FIGURAS ....................................................................................................... VIII LISTA DE TABELAS ...................................................................................................... XVI I. INTRODUÇÃO ................................................................................................................ 1 I.1 Esquistossomose ............................................................................................................... 2 I.1.1 Histórico ........................................................................................................................ 2 I.1.2 Distribuição geográfica.................................................................................................. 3 I.1.2.1 Mundo ......................................................................................................................... 3 I.1.2.2 Brasil ........................................................................................................................... 4 1.2 O ciclo biológico de S. mansoni ...................................................................................... 5 I.3 Genômica e Transcriptômica de S. mansoni .................................................................... 8 I.4 Regulação da expressão gênica em S. mansoni ................................................................ 9 I.5 microRNAs .................................................................................................................... 12 I.5.1 Histórico e Origem ..................................................................................................... 12 I.5.2 Estratégias de Predição e Validação de miRNAs ....................................................... 15 I.5.3 Estratégias de Predição de Alvos de miRNAs............................................................ 17 II. OBJETIVOS................................................................................................................. 19 II.1 Geral ............................................................................................................................. 20 II. 2 Específicos .................................................................................................................. 20 III. Via de silenciamento gênico mediada por miRNAs em S. mansoni ....................... 21 III.1 Justificativa ................................................................................................................. 22 III.2 Materiais e Métodos .................................................................................................... 23 III.2.1 Validação in silico.................................................................................................... 23 III.2.1.1 Análise e localização da via de miRNA no genoma de S. mansoni ..................... 23 III.2.1.2 Alinhamento múltiplo de sequências e Análise filogenética ................................ 23 III.2.1.3 Análise de resíduos hidrofóbicos (Hydrophobic Cluster Analysis - HCA) .......... 24 III.2.1.4 Predição da estrutura secundária ........................................................................... 24

(12) III.2.1.5 Predição da estrutura terciárias ............................................................................. 24 III.2.2 Validação experimental ........................................................................................... 25 III.2.2.1 Parasitos ................................................................................................................ 25 III.2.2.2 Análise da expressão gênica por qRT-PCR .......................................................... 27 III.2.2.2.1 Extração do RNA total ....................................................................................... 27 III.2.2.2.2 Oligonucleotídeos iniciadores (Primers)............................................................ 28 III.2.2.2.3 RT-PCR.............................................................................................................. 28 III.2.2.2.4 Reação da PCR quantitativa em Tempo Real (qRT-PCR) ................................ 28 III.2.2.2.5 Avaliação da curva de eficiência dos iniciadores .............................................. 29 III.2.2.2.6 Verificação da qualidade dos amplicons............................................................ 30 III.2.2.2.7 Curva de dissociação dos amplicons.................................................................. 31 III.2.2.3 Validação dos iniciadores (Seqüenciamento) ....................................................... 32 III.2.2.3.1 Purificação do produto de PCR convencional ................................................... 32 III.2.2.3.2 Freeze Squeze .................................................................................................... 32 III.2.2.3.3 Clonagem ........................................................................................................... 33 III.2.2.3.3.1 Reação de Ligação .......................................................................................... 33 III.2.2.3.3.2 Preparo de células competentes ...................................................................... 33 III.2.2.3.3.3 Transformação Bacteriana .............................................................................. 33 III.2.2.3.3.4 PCR de Colônia............................................................................................... 34 III.2.2.3.3.5 Minipreparação ............................................................................................... 34 III.2.2.3.3.6 Sequenciamento .............................................................................................. 34 III.2.2.4 Análise Estatística ................................................................................................. 35 III.3 Resultados e Discussão ............................................................................................... 36 III.3.1 Análise in silico – Via de silenciamento gênico mediada por miRNAs .................. 36 III.3.1.1 Anotação e localização no genoma de S. mansoni ............................................... 36 III.3.1.1 Exportinas 1, 5 e T ................................................................................................ 40 III.3.1.2 Partner de Dicer e Drosha (RNAseIIIs) ................................................................ 42 III.3.1.3 FMR1 (Fragile-X mental retardation 1) ................................................................ 48 III.3.1.4 Tudor-SN (Tudor staphylococcal nuclease) ......................................................... 51 III.3.2 Análise da expressão gênica .................................................................................... 57 III.3.3 Regulação pós-transcicional em S. mansoni ............................................................ 60 IV. Predição computacional de miRNAs em S. mansoni............................................... 63 IV.1 Justificativa ................................................................................................................. 64

(13) IV.2 Materiais e Métodos ................................................................................................... 66 IV.2.1 Banco de dados de sequências de miRNAs e de S. mansoni ................................... 66 IV.2.2 Identificação de miRNAs maduros e seus precursores (pré-miRNAs) ................... 66 IV.2.3 Identificação de miRNAs conservados .................................................................... 67 IV.2.4 Identificação de miRNAs não conservados ............................................................. 70 IV.2.5 Análise comparativa dos miRNAs identificados em S. mansoni ............................ 70 IV.2.6 Identificação de clusteres de miRNAs ..................................................................... 71 IV.2.7 Conservação e Distribuição Filogenética dos miRNAs de S. mansoni ................... 71 IV.2.8 Análises estatísticas e plotagem de gráficos ............................................................ 72 IV.3 Resultados e Discussão ............................................................................................... 73 IV.3.1 Identificação de miRNAs no genoma de S. mansoni .............................................. 73 IV.3.2 Identificação e Caracterização dos miRNAs maduros ............................................ 76 IV.3.3 Caracterização dos pré-miRNAs de S. mansoni ...................................................... 82 IV.3.4 Distribuição dos genes de miRNAs no genoma de S. mansoni ............................... 89 IV.3.5 Análise dos miRNAs conservados........................................................................... 93 IV.3.5.1 mir-190 de S. mansoni .......................................................................................... 94 IV.3.5.2 miRNA-8 de S. mansoni ....................................................................................... 96 IV.3.5.3 mir-10 de S. mansoni ............................................................................................ 98 IV.3.6 Duplicações dos miRNAs 71 e 2 em S. mansoni................................................... 100 IV.3.7 Clusteres mir-71/2 e mir-71b/2 .............................................................................. 103 V. Cluster Protostômio-específico mir-71/2 .................................................................. 106 V.1 Justificativa ................................................................................................................ 107 V.2 Materiais e Métodos ................................................................................................... 109 V.2.1 Identificação dos miRNAs e regiões genômicas..................................................... 109 V.2.2 Predição computacional dos genes de miRNAs clusterizados................................ 109 V.2.3 Análise Comparativa dos miRNAs clusterizados em mir71/2................................ 111 V.2.4 Conservação evolutiva e Distribuição Filogenética dos miRNAs clustetrizados em mir71/2 .............................................................................................................................. 111 V.2.5 Implementação e plotagem dos gráficos ................................................................. 112 V.3 Resultados e Discussão .............................................................................................. 113 V.3.1 Predição do cluster mir-71/2 ................................................................................... 113 V.3.2 Cluster mir-71/2 Protostômio específico ................................................................ 113 V.3.3 Duplicação do cluster mir-71/2 ............................................................................... 120

(14) V.3.4 Caracterização dos pré-miRNAs ............................................................................. 120 V.3.5 Análise Filogenética e Comparativa dos novos miRNAs ....................................... 125 V.3.6 Conservação dos miRNAs maduros do cluster mir-71/2 ........................................ 129 VI. miRNAs: novos controladores da expressão gênica em S. mansoni? .................. 133 VI.1 Justificativa ............................................................................................................... 134 VI.2 Materiais e Métodos ................................................................................................. 136 VI.2.1 Análise in silico ..................................................................................................... 136 VI.2.1.1 Predição computacional dos alvos de miRNAs no genoma de S. mansoni ........ 136 VI.2.1.2 3’UTR dos mRNAs ............................................................................................ 136 VI.2.1.3 mRNAs alvos ...................................................................................................... 136 VI.2.1.4 Caracterização e Categorização dos RNAm alvos ............................................. 137 VI.2.1.5 Predição de 3'UTR alvo homólogas ................................................................... 137 VI.2.2 Análise in vitro ...................................................................................................... 138 VI.2.2.1 Obtenção dos Parasitos ....................................................................................... 138 VI.2.2.2 Extração de RNA total ........................................................................................ 139 VI.2.2.2.1 miRNAs ........................................................................................................... 139 VI.2.2.2.2 Alvos ................................................................................................................ 140 VI.2.2.3 Obtenção da primeira fita de DNA (cDNA) ....................................................... 141 VI.2.2.3.1 miRNAs ........................................................................................................... 141 VI.2.2.3.2 Alvos ................................................................................................................ 141 VI.2.2.4 Oligonucleotídeos iniciadores ............................................................................ 141 VI.2.2.4.1 miRNAs ........................................................................................................... 142 VI.2.2.4.2 Alvos ................................................................................................................ 142 VI.2.2.5 qRT-PCR ............................................................................................................ 143 VI.2.2.5.1 miRNA............................................................................................................. 143 VI.2.2.5.2 Alvos ................................................................................................................ 143 VI.2.2.5.2.1 Curva de eficiência dos iniciadores .............................................................. 144 VI.2.2.5.2.2 Curva de dissociação dos amplicons ............................................................ 145 VI.2.2.6 Análise estatística ............................................................................................... 146 VI.3 Resultados e Discussão ............................................................................................. 147 VI.3.1 Predição dos alvos de miRNAs ............................................................................. 147 VI.3.2 Ontologia gênica e participação em vias metabólicas ........................................... 152 VI.3.3 Expressão gênica dos miRNAs conservados e não conservados........................... 155

(15) VI.3.3.1 miRNAs sexo-específicos ................................................................................... 159 VI.3.4 Alvos evolutivamente conservados ....................................................................... 162 VI.3.5 Expressão gênica de alvos conservados de S. mansoni ......................................... 165 VI.3.5.1 Smp_066900 inexina (sma-mir-125a) ................................................................ 165 VI.3.5.2 Smp_177060 sinoviolina (sma-mir-124-3p)....................................................... 166 VI.3.6 Controle da expressão gênica ao nível pós-transcricional em S. mansoni ............ 168 VII. CONCLUSÕES ...................................................................................................... 171 VIII. REFERÊNCIAS BIBLIOGRÁFICAS ................................................................ 173 ANEXOS .......................................................................................................................... 200

(16) Resumo Os miRNAs constituem uma classe extensa de pequenos RNAs não codificadores de proteínas possuindo, em sua forma madura, de 20 a 24 nucleotídeos, cuja função principal é regular a expressão gênica. Seus precursores, denominados pré-miRNAs, têm como característica principal a formação de estruturas secundárias estáveis em forma de grampos (hairpins) possuindo um tamanho variável de 70 a 120 nucleotídeos. Os resultados publicados na última década sugerem que o silenciamento gênico mediado pelos miRNAs é um processo evolutivamente conservado e envolve, em um primeiro momento, a interação entre o miRNA e o respectivo RNA mensageiro alvo, promovendo sua clivagem ou repressão de sua tradução. Apesar de o Schistosoma mansoni ser um organismo com genoma conhecido, pouco se conhece sobre o repertório de miRNAs presentes neste parasito. Resultados anteriores do nosso laboratório demonstraram que genes centrais da biogênese de miRNAs são mais expressos em cercárias e esquistossômulos jovens quando comparados a vermes adultos, levando a hipótese de que os mecanismos de adaptação do parasito ao hospedeiro mamífero, imediatamente pós-infecção, podem envolver a participação de miRNAs. Para investigar este hipótese, foram utilizados neste trabalho abordagens computacionais e experimentais para identificar miRNAs em S. mansoni, bem como determinar suas características estruturais e padrão de expressão, correlacionando em paralelo com o perfil de expressão de 13 genes envolvidos em sua biogênese. Os resultados obtidos sugerem que os genes envolvidos na biogênese de miRNAs são conservados e apresentam um perfil de expressão gênica diferencial durante a transição cercária-esquistossômulos jovens. Foram identificados neste trabalho 35 miRNAs conservados, 32 não conservados e mais de 300 prováveis RNA mensageiros alvos no genoma de S. mansoni. Dentre os miRNAs identificados foram caracterizados duplicações gênicas, clusteres (mir-71/2) e miRNAs sexo-específicos. As análises da expressão gênica dos miRNAs conservados e não conservados evidenciaram padrões de expressão gênero-específicos (sma-miR-61, sma-miR-125a e sma-miR-124-3p) e estágio-específicos (sma-mir-new10-5p, sma-miR-125a). Observou-se também uma correlação positiva entre a alta expressão de miRNAs no parasito e baixa expressão de alvos específicos. Estes dados sugerem que a regulação do proteoma do parasito, principalmente nas fases de cercária e esquistossômulos, provavelmente é mediada por regulação pós-transcricional mediada por miRNAs viabilizando a instalação efetiva do parasito no hospedeiro mamífero. Este conjunto de resultados abre perspectiva para avaliação do perfil de expressão em esporocistos demonstrando que transcritos produzidos nesta fase do ciclo biológico do S. mansoni podem ser silenciados e posteriormente traduzidos em cercárias ou esquistossômulos. Palavras-chave: miRNAs, mRNA alvo, Schistosoma mansoni, expressão gênica, regulação póstranscricional. I

(17) Abstract MicroRNAs (miRNAs) are an abundant class of small non-protein-coding RNAs that function as negative gene regulators. These molecules in their mature form are generally 20–24 nucleotides. Their precursors, pre-miRNAs, form a stable stem-loop secondary structure (hairpins) with a variable length (70 to 120 nucleotides). Over the last decade, researchers have been suggesting that the gene silencing mediated by miRNAs is an evolutionarily conserved process and involves the interaction between the miRNA and its target mRNA, promoting its cleavage or repression of protein translation. Although Schistosoma mansoni genome is known, few studies have been done on repertoire of miRNAs and their machinery. Previous results from our laboratory demonstrated that the central genes of Mirna biogenesis is over expressed in cercariae and schistosomula when compared to adult worms, leading to the hypothesis that mechanisms involving participation of miRNAs may help the parasite adaptation, immediately post-infection in mammalian host. To investigate this hypothesis, we performed computational and experimental approaches to identify miRNAs in S. mansoni and to determine their structural features and expression pattern, correlating with the expression profile of 13 genes involved in their biogenesis. These results suggested that genes involved in biogenesis of miRNAs are conserved and showed na over expression profile during the transition from cercariae to young schistosomula. We identified 35 conserved miRNAs, 32 not conserved miRNAs and more than 300 putative targets in the S. mansoni genome. The identified miRNAs were characterized and displayed gene duplication, clusteres (miR-71/2) and sex-specific miRNAs. The analysis of gene expression of conserved and not conserved miRNAs showed gender-specific miRNAs (sma-miR-61, sma-miR-125a and sma-miR-124-3p) and stage-specific miRNAs (sma-mir-new10-5p and sma-mir125a). There was also a positive correlation between high expression of miRNAs in parasite and low expression of their specific targets. These data suggested that the regulation of the parasite proteome, especially in the stages cercaria and schistosomula, is probably mediated by miRNA postranscriptional regulation, enabling the effective installation of the parasite in the mammalian host. This set of results also opens a perspective to evaluate the expression profile in sporocysts demonstrating that mRNAs produced in this stage are silenced and later translated in cercariae or schistosomula. Keywords: miRNAs, mRNA target, Schistosoma mansoni, gene expression, pos- transcriptional regulation. II

(18) LISTA DE ABREVIATURAS, SIGLAS E SÍMBOLOS µg µL µM a.C AMFE BAC ............................................... ............................................... ............................................... ............................................... ............................................... ............................................... BLAST ............................................... BSA CaCl2 cDNA CNPq ............................................... ............................................... ............................................... ............................................... DNA dNTP ............................................... ............................................... EDTA EMT ............................................... ............................................... EST FAPEMIG ............................................... ............................................... FAPESP ............................................... Gb GC GeneDB GO ............................................... ............................................... ............................................... ............................................... HCA ............................................... IPTG Kb KEGG ............................................... ............................................... ............................................... KO LB Mb MFE MFEE ............................................... ............................................... ............................................... ............................................... ............................................... MFEI mg MgCl2 ............................................... ............................................... ............................................... Micrograma Microlitro Micro Molar "antes de Cristo" (Ante Christum) Energia mínima livre ajustada Bacterial artificial chromosome (Cromossomo Artificial de Bactérias) Basic Local Alignment Search Tool Ferramenta de busca de Alinhamento Local Albumina sérica bovina Cloreto de cálcio DNA complementar Conselho Nacional de Desenvolvimento Científico e Tecnológico Ácido desorribonucleico Deoxinucleotídeo trifosfato (N= A, C, G ou T) Ácido etilenodiaminotetracético Esquistossômulos mecanicamente transformados Etiquetas de seqüências expressas Fundação de Amparo a Pesquisa de Minas Gerais Fundação de Amparo à Pesquisa do Estado de São Paulo Giga bases Guanina citosina Gene Data Bank (Banco de dados Gene) Gene Ontology Ontologia Gênica Hydrophobic Cluster Analysis Análise de clusteres hidrofóbicos Isopropil-β-D- tiogalactosidio Kilo bases Kyoto Encyclopedia of Genes and Genomes Enciclopédia Kyoto de Genes e Genomas KEEG orthology Meio de cultura Luria Bertani Mega bases Energia livre mínima Energia mínima livre do conjunto termodinâmico Índice de energia mínima livre Miligramas Cloreto de Magnésio III

(19) MgSO4 miRBase miRNAs mL mRNA NaCl NaOAc NaOH NCBI ............................................... ............................................... ............................................... ............................................... ............................................... ............................................... ............................................... ............................................... ............................................... ncRNAs nm nt PB PCR PERL ............................................... ............................................... ............................................... ............................................... ............................................... ............................................... PFAM ............................................... pH pré-miRNAs pri-miRNAs qRT-PCR ............................................... ............................................... ............................................... ............................................... RefSeq RISC ............................................... ............................................... RNA RT-PCR ............................................... ............................................... SDS stRNAs ............................................... ............................................... TIGR ............................................... Tris UCSC UTR ............................................... ............................................... ............................................... WHO ............................................... Sulfato de magnésio Banco de dados de miRNAs microRNAs Mililitros RNA mensageiro Cloreto de Sódio Acetato de sódio Hidróxido de sódio National Center for Biotechnology Information Centro Nacional para Informações Biotecnológicas RNAs não codificadores de proteínas Nanômetros Nucleotídeos Pares de Bases Reação em Cadeia da Polimerase Practical Extraction and Report Language Linguagem Prática de Extração e Geração de Relatório Protein families database Banco de dados de Fmílias de Proteínas Potencial hidrogeniônico Precursores de miRNAs miRNAs primários Reação Polimerásica em Cadeia quantitativa Sequências de Referência RNA-induced silence complex (Complexo de silenciamento gênico mediado por RNA) Ácido ribonucléico Transcriptase Reversa – Reação Polimerásica em Cadeia Sodio Dodecil Sulfato small temporal RNAs (Pequeno RNA temporal ) Institute for Genomic Research (Instituto de Pesquisas Genômicas) Tris-hidroximetilaminometano University of California, Santa Cruz Untranslated Region (Região não traduzida) World Health Organization – Organização Mundial de Saúde IV

(20) LISTA DE FIGURAS Figura 1: Esquistossomose e sua distribuição mundial (WHO, 2010) – modificado. Figura 2: Distribuição da esquistossomose mansônica de acordo com a prevalência da doença no Brasil – Adaptado de (Coura, 2004). Figura 3: Ciclo de vida do S. mansoni. Dentro do seu hospedeiro vertebrado, as formas larvais (esquistossômulo,A) dão origem a parasitos sexualmente maduros (verme adulto,B), os quais se acasalam e produzem ovos (C) que são liberados para o meio aquático. Os ovos eclodem e liberam os miracídios (D), que penetram nos caramujos, dando origem a numerosos esporocistos (E). Os esporocistos geram cercárias (F) que saem do caramujo e são liberadas na água, as quais são as formas infectantes para o hospedeiro vertebrado (Verjovski-Almeida et al., 2003). Figura 4: Expressão gênica estágio-específico em S. mansoni. A figura representa os genes altamente expressos estágios-específicos baseados nos projetos transcriptoma do parasito (Han et al., 2009). Figura 5: Mecanismo de silenciamento gênico mediada por miRNAs. Figura 5: O mecanismo de silenciamento gênico mediada por miRNAs ocorre em dois passos distintos: um nuclear (a, b, c) e outro citoplasmático, sendo finalizada quando uma das fitas do duplex encontra mi-RISC e seu respectivo mRNA alvo (d, e, f). (Adaptado de (Naqvi et al., 2009). Figura 6: Preparação de esquistossômulos de 24 horas. Os esquistossômulos foram cultivados por 24 horas em estufa de CO2 5% a 37ºC em meio 169 analisados em lupa de aumento. Figura 7: Análise em gel de agarose/formaldeído a 1%. O RNA total foi obtido utilizando o kit SV40 a partir de vermes adultos (1), cercárias (2), esquistossômulos de 3,5 horas (3); esquistossômulos de 24 horas (4); esquistossômulos de 48 horas(5); esquistossômulos de 72 horas (6); esquistossômulos de 5 dias (7) e esquistossômulos de 7 dias (8). Figura 8: Plot de amplificação referente à curva de eficiência do α tubulina utilizando diluição seriada de 4x de cDNA de cercária. Em X está demonstrado o valor dos ciclos de PCR e em Y os valor de ∆Rn. Figura 9: Curva padrão referente ao gene α tubulina utilizando diluição seriada de 4x de cDNA. Em X estão demonstrados os valores de Log da concentração de cDNA e em Y os valores de CT correspondes a cada diluição. A direita do gráfico os valores de slope e de coeficiente de linearidade estão representados. V

(21) Figura 10: Curva de dissociação referente ao amplicon de SmTudor-SN. No eixo x está representado a temperatura de dissociação do amplicon gerado pela reação de PCR e no eixo Y a derivada do valor de emissão de fluorescência. Figura 11: Distribuição evolutiva das proteínas XPO5, XPO1 e XPOt. Árvore filogenética consenso baseada na sequências de resíduos de aminoácidos das proteínas XPO5 , XPO1 e XPOT. Para árvore consenso e confiabilidade dos ramos formados foram utilizados testes de bootstrap com 2000 réplicas e mínimo de 50% para cada ramo confiável. A árvore mostrou 3 clados distintos (separado por colchetes) sendo um para cada conjunto de proteínas ortólogas. As proteínas evidenciadas em caixa cinza representam as proteínas identificadas neste trabalho. A construção da árvore e a análise do “bootstrap” foram realizadas no programa MEGA 4.0. Figura 12: Conservação evolutiva dos domínios de XPO5, XPO1 e XPOt. As proteínas ortólogas XPO5, XPO1 e XPOt encontradas nos organismos D. melanogaster, C. elegans e H. sapiens e aquelas identificadas no parasito S. mansoni foram comparadas quanto a disposição e presença de domínios conservados na estrutura primária. A descrição de cada domínio foi representada na estrutura por um polígono indicado no rodapé da Figura juntamente com os números PFAM. O tamanho de cada proteína está indicado no final de cada sequência e os valores comparativos de cada domínio estão indicados a direita de cada sequência. Figura 13: Distribuição evolutiva das proteínas partner-Drosha e partner-Dicer. A árvore filogenética consenso foi baseada na sequências de resíduos de aminoácidos das proteínas partner-Drosha e partner-Dicer. Para árvore consenso e confiabilidade dos ramos formados foram utilizados testes de bootstrap com 2000 réplicas e mínimo de 50% para cada ramo confiável. A árvore mostrou 2 clados distintos (caixas cinza) sendo um para cada conjunto de proteínas ortólogas. As proteínas evidenciadas em negrito representam as proteínas identificadas neste trabalho. A construção da árvore e a análise do “bootstrap” foram realizadas no programa MEGA 4.0. Figura 14: Conservação evolutiva dos domínios de partner-Drosha e partner-Dicer. As proteínas ortólogas partner-Drosha e partner-Dicer encontradas nos organismos D. melanogaster, C. elegans e H. sapiens e aquelas identificadas no parasito S. mansoni foram comparadas quanto a disposição e presença de domínios conservados na estrutura primária. Cada domínio esta representado por uma caixa cinza entre o inicio e o termino dos resíduos de aminoácidos da proteína. O tamanho de cada proteína está indicado no final de cada sequência e os valores comparativos de cada domínio estão indicados a direita de cada sequência. Figura 15: Conservação evolutiva dos domínios de FMR1. As proteínas ortólogas FMR1 encontradas nos organismos D. melanogaster e aquelas identificadas no parasito S. mansoni foram comparadas quanto a disposição e presença de domínios conservados na estrutura primária. Cada domínio está representado por uma caixa cinza entre o inicio e o termino dos resíduos de aminoácidos da proteína. O tamanho de cada proteína está indicado no final de cada sequência e os valores comparativos de cada domínio estão indicados a direita de cada sequência. VI

(22) Figura 16: Distribuição evolutiva das proteínas FMR1. A árvore filogenética consenso foi baseada na sequências de resíduos de aminoácidos de proteínas ortólogas FMR1. Para árvore consenso e confiabilidade dos ramos formados foram utilizados testes de bootstrap com 2000 réplicas e mínimo de 50% para cada ramo confiável. A árvore mostrou clados distintos (representados por colchetes) sendo um para cada grupo de proteínas ortólogas. As proteínas evidenciadas em caixas representam as proteínas identificadas neste trabalho. A construção da árvore e a análise do “bootstrap” foram realizadas no programa MEGA 4.0. Figura 17: Estruturas secundárias e resíduos hidrofóbicos das proteínas contendo domínio SN. As proteínas termonuclease (Staphylococcal Nuclease -2SNS) e SmTudor-SN foram representadas na forma 2D evidenciando a estrutura secundária e os resíduos hidrofóbicos de cada porção da proteína. As estruturas secundárias foram preditas pelo programa PredictProtein e representadas por retângulos verticais azuis as α hélices e pelos retângulos verticais vermelhos as folhas beta. Os domínios SN foram indicados em cada estrutura por um traço contínuo preto mostrando em suas extremidades o resíduo de aminoácido inicial e final. Os residuos de aminoácidos foram representados pelas letras referentes exceto prolina, glicina, serina e treonina que foram representados por ★,◆,▣ e □, respectivamente. Os sítios catalíticos presentes na proteína 2SNS, descritos por, Ponting (1997) foram mostrados por setas (D21, F34, D40, E43, K84, Y85 and R87). A sequência β1β2-β3-α1-β4-β5-α2-α3 foram mostradas no gráfico representando a sequência de estruturas secundárias caracteristica de domínios SN. As estruturas secundárias foram preditas utilizando o programa PredictProtein. Figura 18: Estruturas tridimensionais dos domínios conservados SN em SmTudor-SN e Staphylococcal Nuclease (2SNS). A ilustraçao em forma de desenho foi obtida atavés da modelagem baseada em homologia no banco de dados repositório Swiss-Model. O programa Pymol foi utilizado para exposição dos domínios SN obtidos das proteínas SmTudor-SN e Staphylococcal Nuclease. As estruturas α hélices foram representadas pelas cores vermelho, amarelo e azul claro e as folhas beta representadas por setas azuis e verdes. Figura 19: Distribuição evolutiva das proteínas Tudor-SN. A árvore filogenética consenso foi baseada na sequências de resíduos de aminoácidos de proteínas ortólogas Tudor-SN encontradas em três diferentes reinos: Fungi, Plantae e Metazoa. Para árvore consenso e confiabilidade dos ramos formados foram utilizados testes de bootstrap com 2000 réplicas e mínimo de 50% para cada ramo confiável. A árvore mostrou clados distintos (representados por colchetes) sendo um para cada reino. As proteínas evidenciadas em caixas representam as proteínas identificadas neste trabalho. A construção da árvore e a análise do “bootstrap” foram realizadas no programa MEGA 4.0. Figura 20: Expressão relativa dos gene (A) SmDrosha1/2 e (B) SmExportina5.1/2 no desenvolvimento de S. mansoni. A expressão destes genes foi avaliada nos estágios de cercárias, esquistossômulos mecanicamente transformados (EMT-3,5 horas, EMT-24 horas, EMT-48 horas, EMT-72 horas, EMT-5 dias, EMT-7 dias) e vermes adultos. Como normalizador (gene constitutivo) foi utilizado o gene da α-tubulina e a expressão gênica relativa foi determinada pelo método do 2-ΔCt. A análise estatística foi realizada utilizando o teste de Tukey com P<0,05 no programa GraphPad Prism. As diferenças estatísticas entre os estágios foram determinadas pelos sinais: * diferente de cercária, ** diferente de EMT-3,5 VII

(23) horas, *** diferente de EMT-24 horas, # diferente de EMT-48 horas, ## diferente de EMT-72 horas, ### diferente de EMT-5 dias, & diferente de EMT-7 dias. Figura 21: Expressão relativa dos gene (A) SmPartner-Dicer e (B) SmPartner-Drosha no desenvolvimento de S. mansoni. A expressão destes genes foi avaliada nos estágios de cercárias, esquistossômulos mecanicamente transformados (EMT-3,5 horas, EMT-24, EMT48 horas, EMT-72 horas, EMT-5 dias, EMT-7 dias) e vermes adultos. Como normalizador (gene constitutivo) foi utilizado o gene da α-tubulina e a expressão gênica relativa foi determinada pelo método do 2-ΔCt. A análise estatística foi realizada utilizando o teste de Tukey com P<0,05 no programa GraphPad Prism. As diferenças estatísticas entre os estágios foram determinadas pelos sinais: * diferente de cercária, ** diferente de EMT-3,5 horas, *** diferente de EMT-24 horas, # diferente de EMT-48 horas, ## diferente de EMT-72 horas, ### diferente de EMT-5 dias, & diferente de EMT-7 dias. Figura 22: Expressão relativa dos gene (A) SmTudor-SN e (B) SmFmr1.1 no desenvolvimento de S. mansoni. A expressão destes genes foi avaliada nos estágios de cercárias, esquistossômulos mecanicamente transformados (EMT-3,5 horas, EMT-24 horas, EMT-48 horas, EMT-72 horas, EMT-5 dias, EMT-7 dias) e vermes adultos. Como normalizador (gene constitutivo) foi utilizado o gene da α-tubulina e a expressão gênica relativa foi determinada pelo método do 2-ΔCt. A análise estatística foi realizada utilizando o teste de Tukey com P<0,05 no programa GraphPad Prism. As diferenças estatísticas entre os estágios foram determinadas pelos sinais: * diferente de cercária, ** diferente de EMT-3,5 horas, *** diferente de EMT-24 horas, # diferente de EMT-48 horas, ## diferente de EMT-72 horas, ### diferente de EMT-5 dias, & diferente de EMT-7 dias. Figura 23: Mecanismo proposto da via de silenciamento gênico mediada por miRNAs no parasito S. mansoni. A via de miRNA envolve grupos de proteínas nucleares e citosólicas. As proteínas nucleares têm a função de expressar e processar o miRNA primário e posteriormente exportá-lo para o citoplasma. No citoplasma, proteínas processam os precursores de miRNA transformando-os em moléculas ativas aptas a atuarem no processo de regulação da expressão gênica. Figura 24: Fluxograma da abordagem computacional para identificação de miRNAs conservados e não conservados em S. mansoni Figura 25: miRNAs maduros em S. mansoni. A frequência de cada nucleotídeo presente nos miRNAs maduros de S. mansoni estão indicados pelos logos U (uracila), A (adenina),C (citosina), G (Guanina). As posições são indicadas pelos números no eixo x e o tamanho de cada logo indica a relativa freqüência de cada nucleotídeo naquela posição específica. Figura 26: Conservação de sma-mir-8 no grupo Bilateria. A alta fidelidade nos alinhamentos entre os precursores sma-mir-8 e seus respectivos ortólogos de Ecdysozoa e Lophotrochozoa foram analisadas utilizando Clustal 2.0 e RNAalifold. As formas maduras dos miRNAs são mostradas nas caixas cinza. Os respectivos grupos taxonômicos foram agrupados em colchetes. VIII

(24) Figura 27: Características estruturais e termodinâmicas de pré-miRNAs. Os valores utilizados (A) MFE, (B) AMFE, (C) MFEI e (D) Conteúdo de GC foram baseados nos prémiRNAs depositados no banco de dados miRBase provenientes de diferentes grupos de espécies como Animais, Bilateria, Deuterostômios, Ecdysozoa, Lophotrochozoa, S. japonicum assim como dos pré-miRNAs identificados neste trabalho. As caixas representam 50% dos dados analisados. A extremidade mais baixa do e Box plot é o primeiro quartil ou 25 % e a extremidade mais alta representa o terceiro quartil ou 75 %. A linha horizontal dentro da caixa representa a mediana e os valores maiores que 1,5 vezes a mediana são os “outliers”. Figura 28: Características estruturais e termodinâmicas de pré-miRNAs. Os valores utilizados (A) MFEE, (B) Diversidade do conjunto termodinâmico, (C) Freqüência da estrutura de energia mínima livre no conjunto termodinâmico e (D) Tamanho foram baseados nos pré-miRNAs depositados no banco de dados miRBase provenientes de diferentes grupos de espécies como Animais, Bilateria, Deuterostômios, Ecdysozoa, Lophotrochozoa, S. japonicum assim como dos pré-miRNAs identificados neste trabalho. As caixas representam 50% dos dados analisados. A extremidade mais baixa do e Box plot é o primeiro quartil ou 25 % e a extremidade mais alta representa o terceiro quartil ou 75 %. A linha horizontal dentro da caixa representa a mediana e os valores maiores que 1,5 vezes a mediana são os “outliers”. Figura 29: Distribuição dos preditos miRNAs nos cromossomos scaffolds de S. mansoni. A localização relativa de cada pré-miRNAs nos cromossomos de S. mansoni (versão 5.0) mostrou a presença destes em 7 cromossomos autossômicos e um cromossomo sexual (W). As linhas pretas representam os pré-miRNAs em suas respectivas posições. As setas indicam a presença dos dois clusteres encontrados em S. mansoni: sma-mir-71/2 e sma-mir71b/2. Figura 30: Distribuição filogenética dos miRNAs em genomas animais. Os miRNAs conservados encontrados em S. mansoni foram comparados com seus respectivos ortólogos em espécies de animais. “X” indica a presença do miRNA em ao menos uma espécie dentro do clado. Os quadros acima apresentam os nomes de cada família de miRNA. A filogenia simplificada foi baseada em Jones e Blaxter, 2005 (Jones and Blaxter, 2005). Figura 31: Análise estrutural comparativa entre sma-mir-190 e sja-mir-190. (A) O alinhamento global das estruturas secundárias dos precursores sma-mir-190 e sja-mir-190 foram realizados utilizando os programas ClustalX 2.0 e RNAalifold. Os miRNAs maduros mir-190-3p e mir-190-5p foram mostrados no alinhamento dentro de caixas tracejadas. (B) O dobramento consenso das estruturas secundárias dos precursores sja-mir-190 e sma-mir-190 foi realizado utilizando RNAalifold. Os miRNAs maduros foram representados em uma caixa amarela. Figura 32: Distribuição evolutiva do miRNA sma-mir-8 no grupo Bilateria (a) As relações filogenéticas foram referidas entre os precursores sma-mir-8 e seus homólogos. A árvore filogenética foi gerada utilizando o método Neighbor-Joining, e o modelo Kimura-2parâmetros, ambos executados no programa MEGA 4.0. Os clados distintos apresentaram os grupos Deuterostômios (miR-429, miR-200 e mir-141 genes) e o grupo Ecdysozoa /Lophotrochozoa (mir-8 gene). Somente os “bootstrap” acima de 30 foram considerados para 2000 réplicas analisadas. IX

(25) Figura 33: Conservação do miRNA sma-mir-10 no grupo Bilateria (a) As relações filogenéticas foram referidas entre os precursores sma-mir-10 e seus ortólogos. A árvore filogenética foi gerada utilizando o método Neighbor-Joining, e o modelo Kimura-2parâmetros, ambos executados no programa MEGA 4.0. Os clados distintos apresentaram os grupos Deuterostômios, Ecdysozoa e Lophotrochozoa. Somente os “bootstraps” acima de 30 foram considerados para 2000 réplicas analisadas. (b) A alta fidelidade nos alinhamentos entre os precursores sma-mir-10 e seus respectivos ortólogos de Ecdysozoa e Lophotrochozoa foram realizadas usando Clustal 2.0 e RNAalifold. As formas maduras dos miRNAs são mostradas nas caixas cinza. Figura 34: Conservação do miRNA dos genes sma-mir-71 e sma-mir-71b no grupo Bilateria. (a) As relações filogenéticas foram referidas entre os precursores da família mir71. A árvore filogenética foi gerada utilizando o método Neighbor-Joining, e o modelo Kimura-2-parâmetros, ambos executados no programa MEGA 4.0. Os clados distintos apresentaram os grupos Deuterostômios (Cephalochordata, Echinodermata e Hemichordata), Ecdysozoa e Lophotrochozoa. Somente os “bootstraps” acima de 30 foram considerados para 2000 réplicas analisadas. (b) A alta fidelidade nos alinhamentos entre os precursores smamir-71, sma-mir-71b e seus respectivos ortólogos de Ecdysozoa e Lophotrochozoa foram realizadas usando Clustal 2.0 e RNAalifold. As formas maduras dos miRNAs são mostradas nas caixas cinza. Figura 35: Clusteres de miRNAs no genoma de S. mansoni. As estruturas secundárias dos clusteres sma-mir-71/2 e sma-mir-71b/2 foram realizadas por RNAfold (Hofacker, 2009). A posição nos cromossomos, tamanho e direção da fita são mostradas nas caixas cinza abaixo da figura. Figura 36:Árvore evolutiva e representação dos genes mir-71, mir-2 e mir-13. A árvore representa um esquema dos genes de miRNAs mir-71, mir-2 e mir-13 na escala evolutiva. A disposição destes genes em diversas espécies é representada por barras horizontais com seta indicando a presença do gene. A legenda mostra as formas dispostas na figura e suas denominações. A disposição dos ramos da árvore foi extraída de Hashimoto-Gotoh, 2009. Figura 37: Análise conservativa das estruturas dos genes cbr-mir-2 e cel-mir-2. A estrutura secundária dos genes é mostrada pelos sinais, “(“, “)”, “.”, acima do alinhamento global. A estrutura do miRNA maduro conservada é mostrada pelo retângulo pontilhado preto. A região seed do miRNA maduro é mostrada na parte inferior da figura. Figura 38: Estruturas secundárias dos precursores de miRNAs Protostômios-específicos mir-71, mir-2, mir-13. O programa RNAFold do pacote Vienna foi utilizado para elucidação da estrutura secundária. Os miRNAs maduros são evidenciados por uma caixa cinza. Figura 39: Distribuição dos valores relacionados às características (A) Conteúdo de GC e (B) MFE dos novos precursores de miRNAs. Os valores utilizados na confecção dos gráficos foram baseados em precursores de miRNAs depositados no banco de dados miRBase. Os nomes dos novos miRNA estão representados em cada gráfico do grupo de miRNA correspondente. As caixas representam 50% dos dados analisados. A extremidade mais baixa representa o primeiro quartil ou 25 % dos dados e a extremidade mais alta X

(26) representa o terceiro quartil ou 75 % dos dados. A linha horizontal dentro da caixa representa a mediana e os valores maiores que 1,5 vezes a mediana são os “outliers”. Figura 40: Distribuição evolutiva dos novos mir-13 no grupo Protostômios. As relações filogenéticas foram referidas entre os novos precursores de mir-13 e seus homólogos. A árvore filogenética foi gerada utilizando como método Neighbor-Joining, como modelo Kimura-2-parâmetros e executada no programa MEGA 4.0. Os clados distintos apresentaram os grupos mir-13a e mir-13/13b. Somente “bootstrap” acima de 30 foram considerados para 2000 réplicas analisadas. Figura 41: Conservação dos novos mir-13 no grupo Protostômios O alinhamento múltiplo de sequência entre os precursores de mir-13 e seus respectivos ortólogos de Ecdysozoa e Lophotrochozoa foram realizadas usando ClustalX 2.0 e RNAalifold. As formas maduras dos miRNAs são mostradas nas caixas cinza. Figura 42: Conservação dos novos mir-71 no grupo Protostômios (a) As relações filogenéticas foram referidas entre os novos mir-71 e seus ortólogos. A árvore filogenética foi gerada utilizando como método Neighbor-Joining, como modelo Kimura-2-parâmetros e executada no programa MEGA 4.0. Os clados distintos apresentaram os grupos Deuterostômios, Ecdysozoa e Lophotrochozoa. Somente “bootstraps” acima de 30 foram considerados para 2000 réplicas analisadas (b) O alinhamento múltiplo de sequência entre os precursores de mir-71 e seus respectivos ortólogos de Ecdysozoans e Lophotrochozoans foram realizadas usando ClustalX 2.0 e RNAalifold. As formas maduras dos miRNAs são mostradas nas caixas cinza. Figura 43: miRNAs maduros da família mir-2. Representação Weblogo das sequências maduras dos miRNAs mir-2 e as sequências maduras dos novos miRNAs identificados. A caixa cinza corresponde a região seed dos miRNAs maduros entre os nucleotídeos 2 e 8. Figura 44: miRNAs maduros da família mir-13. Representação Weblogo das sequências maduras dos miRNAs mir-13 e as sequências maduras dos novos miRNAs identificados. A caixa cinza corresponde a região seed dos miRNAs maduros entre os nucleotídeos 2 e 8. Figura 45: miRNAs maduros da família mir-71. Representação Weblogo das sequências maduras dos miRNAs mir-71 e as sequências maduras dos novos miRNAs identificados. A caixa cinza corresponde a região seed dos miRNAs maduros entre os nucleotídeos 2 e 8. Figura 46: RNA total obtido a partir de formas evolutivas do S. mansoni. O RNA total foi obtido utilizando o kit SV40 a partir de verme adulto (1) e cercária (2) Figura 47: Plot de amplificação referente à curva de eficiência do gene α tubulina. Em X está demonstrado o valor dos ciclos de PCR e em Y os valor de ∆Rn. Foi utilizado cDNA de cercária e uma diluição seriada de 4 vezes. Figura 48: Curva padrão referente ao gene α tubulina. Em X estão demonstrados os valores de Log da concentração de cDNA e em Y os valores de CT correspondes a cada XI

(27) diluição. Os valores de slope e de coeficiente de linearidade estão representados a direita do gráfico. Foi utilizado cDNA de cercária e uma diluição seriada de 4 vezes. Figura 49: Representação dos termos “GO” associados aos alvos de miRNAs em S. mansoni. Os termos GO foram contados por contagem única representando um total de 127 termos ancestrais GO-Slim. Figura 50: Expressão gênica dos miRNAs, conservados e não conservados, identificados no genoma de S. mansoni. Os genes (a) sma-mir-124-3p, (b) sma-mir-8-3p, (c) sma-mir-363p, (d) sma-mir-61, (e) sma-mir-125a, (f) sma-mir-190-5p, (g) sma-mir-3479-3pe (conservados) e (h) sma-mir-new10-5p (não conservado) foram avaliados quanto a expressão gênica por qRT-PCR nas fases de cercária, esquistossômulo de 3,5 horas e 24 horas e vermes adultos fêmeas e machos. Como normalizador (gene constitutivo) foi utilizado o gene da U6 e a expressão gênica relativa foi determinada pelo método do 2-ΔCt. A análise estatística foi realizada utilizando o teste de Tukey com p<0,05 no programa GraphPad Prism. As diferenças estatísticas entre os estágios foram determinadas pelos sinais: * diferente de cercária, ** diferente de EMT-3,5 horas, *** diferente de EMT-24 horas, # diferente de vermes fêmea. Figura 51: Expressão gênica relativa dos genes alvos Sinoviolina e Inexina. As expressões relativas dos genes sinoviolina e inexina foram analisadas utilizando Real Time PCR nas fases cercária e vermes adultos. Como normalizador (gene constitutivo) foi utilizado o gene da α-tubulina e a expressão gênica relativa foi determinada pelo método do 2-ΔCt. A análise estatística foi realizada utilizando o teste de Tukey com P<0,05 no programa GraphPad Prism. As diferenças estatísticas entre os estágios foram determinadas pelos sinais: * diferente de cercária. Figura 52: Controle da expressão gênica em S. mansoni. A contribuição dos mecanismos pós-transcricionais, como silenciamento gênico mediado por miRNAs, tem sido mais efetiva no controle da expressão gênica em estágios larvais do parasito S. mansoni. Os retângulos vermelhos tracejados representam as relativas expressões dos genes da via de miRNAs e de seus efetores. XII

(28) LISTA DE TABELAS Tabela 1: Hospedeiros intermediários e região de maior endemicidade dos parasitos do gênero Schistosoma. Tabela 2- Meio 169 com seus componentes e concentração. Tabela 3: Sequência de primers forward e reverse referente aos genes avaliados, tamanho do amplicon gerado, eficiência e R2 dos primers utilizados avaliado através de uma curva de eficiência. Tabela 4: Expansão dos genes envolvidos na via de silenciamento gênico mediada por miRNAs no genoma de S. mansoni. Tabela 5: Comparação entre o repertório de miRNAs identificados neste trabalho e os identificados por Simões, 2011. Tabela 6: miRNAs maduros em S. mansoni. Tabela 7: Comparação das características dos pré-miRNAs de Lophotrochozoa e S. mansoni. Tabela 8: Pré-miRNAs de S. mansoni e suas características estruturais e termodinâmicas. Tabela 9: Localização dos preditos pré-miRNAs no genoma e nos cromossomos scaffolds de S. mansoni. Tabela 10: Sequências preditas dos miRNAs maduros, miRNA mir-2, mir-13 e mir-71, seus respectivos ortólogos no miRBase e suas predições pelos programas MapMi e Mirortho. Tabela 11: Características estruturais e termodinâmicas dos novos precursores Protostômios-específicos. Tabela 12: Número de acesso das sequências e oligonucleotídeos iniciadores referentes aos miRNAs avaliados. Tabela 13: Número de acesso das sequências e oligonucleotídeos iniciadores referentes aos alvos de miRNAs. Tabela 14: Número de prováveis RNA mensageiros alvos dos miRNAs maduros identificados no genoma de S. mansoni. XIII

(29) Tabela 15: Ontologia gênica de miRNA em S. mansoni. Tabela 16: Associação entre os miRNAs identificados em S. mansoni, alvos preditos no genoma e alguns identificadores. Tabela 17: Alvos preditos em S. mansoni e S. japonicum usando conservação evolutiva do pareamento miRNA/3`UTR. . XIV

(30) INTRODUÇÃO CAPÍTULO I INTRODUÇÃO 1

(31) INTRODUÇÃO I.1 Esquistossomose I.1.1 Histórico Embora descoberta em 1851 pelo patologista alemão Theodore Bilharz, o qual confirmou a presença do verme conhecido atualmente como Schistosoma hematobium nas veias mesentéricas de um camponês egípcio autopsiado, ovos de Schistosoma foram encontrados em múmias egípcias datadas de 3500 a.C. Apesar da síndrome de Katayama ter sido descrita por Fuji em 1847, quatro anos antes da descoberta de Bilharz, ela somente foi identificada como a forma aguda de infecção pelo S. japonicum tempos depois(Fuji, 1847). Em 1902, Manson encontrou ovos com espícula lateral em pacientes das Antilhas, admitindo a existência de uma nova espécie de Schistosoma, a qual foi classificada como S. mansoni por Sambon em 1907 (Manson, 1902; Sambon, 1907). Esta mesma espécie teve sua presença confirmada no Brasil, através da descrição de quatro casos, registrados pelo médico e pesquisador Manuel Augusto Pirajá da Silva, 1908, no artigo intitulado “Contribuição para o estudo da Schistosomíase na Bahia”(Pirajá da Silva, 1908; Passos, 1998). A palavra Schistosoma é derivada do grego que significa literalmente “corpo fragmentado”, referindo-se a anatomia dióica da maioria das espécies. Existem seis espécies dentro do gênero Schistosoma que infectam seres humanos: S. mansoni, S. hematobium, S. japonicum, S. intercalatum, S. mekongi e S. malayensis; entretanto, somente uma delas, S. mansoni, existe no Brasil. Em 1914, os moluscos do gênero Oncomelamia foram apontados como hospedeiros intermediários de S. japonicum; em 1915, Leiper identificou Bulinus e Biomphalaria, na África, como hospedeiros intermediários de S. hematobium e S. mansoni, respectivamente (Coura, 2004). A tabela 1 mostra os hospedeiros intermediários e a região de maior endemicidade do parasito. Das dez espécies e subespécies do gênero Biomphalaria descritas apenas três são hospedeiros naturais do parasito (B. glabrata, B. tenagophila, B. straminea) e duas (B. amazonica, B. peregrina) consideradas hospedeiros potenciais por terem sido somente infectados experimentalmente (Paraense, 1966; Paraense, 1981). 2

(32) INTRODUÇÃO Tabela 1: Hospedeiros intermediários e região de maior endemicidade dos parasitos do gênero Schistosoma. Parasito Schistosoma S. mansoni Hospedeiro intermediário Biomphalaria S. mekongi S. intercalatum S. japonicum S. haematobium Tricula Bulinus Oncomelania Bulinus Região de endemicidade África, Oriente Médio, Caribe e Sul da Ásia Ásia África Ásia África e Oriente Médio I.1.2 Distribuição geográfica I.1.2.1 Mundo A esquistossomose ou barriga d’água é uma doença crônico-debilitante causada por parasitos platelmintos do gênero Schistosoma. De acordo com a Organização Mundial de Saúde, a esquistossomíase é uma doença milenar que atualmente tem afetado mais de 207 milhões de indivíduos distribuídos em 76 países nos continentes africano, asiático e americano (Figura 1)(WHO, 2010). No entanto, o número de países onde existe a transmissão da esquistossomose tem diminuído nos últimos anos devido à utilização de intervenções públicas no controle da doença. A esquistossomose é mais prevalente no continente africano onde vivem aproximadamente 90% dos indivíduos infectados. Entre estes, 10% apresentam a forma severa da doença e aproximadamente 50% (em torno de 100 milhões de indivíduos) exibem manifestações clínicas da doença, constituindo um sério problema de saúde pública. Também vale destacar que, anualmente, ocorrem de 250 a 300 mil mortes em decorrência desta parasitose estimando-se que 500 a 600 milhões de pessoas estão em risco de contaminação (WHO, 2010). 3

(33) INTRODUÇÃO Figura 1: Esquistossomose e sua distribuição mundial (WHO, 2010) – modificado. I.1.2.2 Brasil No Brasil, acredita-se que a esquistossomose mansônica tenha sido introduzida através do tráfico negreiro, tendo como porta de entrada o estado da Bahia. O fluxo migratório que se seguiu em virtude da colonização do país, aliado a não realização de inquéritos coproscópicos por quase meio século no Brasil, contribuíram de maneira significativa, para a disseminação do parasito no país. Além disso, a exploração inadequada de recursos hídricos, a distribuição ampla dos hospedeiros intermediários, a longevidade da doença e a falta de educação em saúde também foram somatórios para esta propagação da esquistossomose (Coura, 2004). Considera-se como área endêmica no Brasil a região que compreende o estado do Maranhão até o Espírito Santo, incluindo Minas Gerais. Observam-se também focos isolados no Distrito Federal e nos estados do Pará, Piauí, Goiás, Rio de Janeiro, São Paulo, Paraná, Santa Catarina e Rio Grande do Sul (Figura 2) (Coura, 2004). 4

(34) INTRODUÇÃO Figura 2: Distribuição da esquistossomose mansônica de acordo com a prevalência da doença no Brasil – Adaptado de (Coura, 2004). 1.2 O ciclo biológico de S. mansoni O parasito S. mansoni pertence à família Schistosomatidae, classe Trematoda, subclasse Digenea e gênero Schistosoma. Este gênero se difere dos outros da mesma subclasse por apresentar sexos separados (Rey, 2001). O ciclo de vida deste parasito, descrito por Leiper em 1915, é do tipo heteroxênico envolvendo uma passagem por um hospedeiro invertebrado, representado por moluscos do gênero Biomphalaria e um hospedeiro definitivo, representado pela espécie humana, conforme Figura 3 (Verjovski-Almeida et al., 2003). Uma vez na água, e sob os estímulos de luz e temperatura apropriadas, os ovos eclodem liberando a forma larval infectante denominada miracídio. Neste estágio, a larva miracídio, nada ativamente até encontrar o hospedeiro invertebrado, caramujo do gênero Biomphalaria, penetrando em seu tecido mole. Imediatamente após penetrar na hemocele do caramujo, o miracídio sofre metamorfose, transformando se em esporocisto-mãe. Neste estágio o parasito necessita de grande aporte de alimento, mas, como ainda não possui tubo 5

(35) INTRODUÇÃO digestivo, adquire seus nutrientes por difusão ou transporte ativo. Os esporocistos mãe desenvolvem-se por multiplicação assexuada gerando numerosos esporocistos-filhos ou esporocistos secundários que irão migrar para o hepatopâncreas do caramujo onde continuarão dando origem à terceira geração de larvas, denominadas cercárias. Atingida a maturidade, estas migram através da hemocele do caramujo para a cavidade do manto, abandonando o caramujo e migrando para a água doce. A cercária possui órgão anterior ou ventosa oral, segmento do corpo e cauda bifurcada para propulsão. Esta última região da cercária, no seu processo de penetração no hospedeiro definitivo, é eliminada. não se alimentando no meio externo possuindo vida curta. Nesta fase a principal fonte de energia para a larva são os estoques de carboidratos principalmente glicogênio (Wilson and Barnes, 1979). O homem infecta-se por contato com água que contenha cercária. A cercária de Schistosoma deve ultrapassar uma importante barreira mecânica oferecida pela pele do mamífero. Para este fim, a larva infectante é equipada com dois pares de células glandulares, situadas em posição anterior à ventosa ventral e três pares posteriores a ela. O conteúdo destas glândulas é secretado através de ductos que se abrem na porção anterior da larva. O conjunto posterior de glândulas secreta principalmente muco para auxiliar na aderência à pele (Dorsey et al., 2002). Após a infecção, ocorrem algumas alterações estruturais no parasito em decorrência da mudança de ambiente. Além da perda da cauda o parasito modifica o tipo de respiração (aeróbica para anaeróbica), altera o glicocálix e se metamorfeia atingindo o estágio de esquistossômulo. Os esquistossômulos permanecem nos tecidos da apiderme e derme por 2 a 3 dia. Por volta do quarto dia, se os esquistossômulos não forem destruídos pelo sistema imune do hospedeiroos eles penetram nos vasos sanguíneos sendo carregados passivelmente em direção aos pulmões e coração. Por volta do sétimo e nono dia após a infecção eles atingem o pulmão (Clegg, 1965). A partir do oitavo dia o verme passa por diversos órgãos e já podem ser localizado no sistema porta intra-hepático, onde se alimentam do sangue do hospedeiro definitivo, iniciam a divisão celular crescendo e amadurecendo até o final da terceira-quarta semana (REY, 2001). Decorridas aproximadamente quatro semanas, os vermes se acasalam e começam o processo de oviposição (Cunha, 1970; Roberts, 2000). A partir deste momento, a resposta do hospedeiro mamífero à produção de ovos pelas fêmeas dá origem a patogenia da esquistossomose. A simples presença dos vermes adultos no sistema porta-hepático não oferece risco à saúde humana devido ao fato dos parasitas não se multiplicarem neste habitat. Entretanto, a produção de aproximadamente 300 ovos/dia/fêmea 6

(36) INTRODUÇÃO e a conseqüente liberação de antígenos solúveis pelo ovo no tecido hepático, induz o aparecimento de uma intensa reação inflamatória em torno do ovo, a qual posteriormente, por um processo de fibrose dará origem ao granuloma. Hipertensão portal, esplenomegalia e ascite são ao longo prazo, características marcantes da infecção pelo S. mansoni (Caldas et al., 2008). A Figura 3 ilustra as macroestruturas formadas nos 3 diferentes habitats do parasito, hospedeiro definitivo, hospedeiro intermediário e ambiente aquático enfatizando os aspectos macromorfológicos distintos de cada estágio. Figura 3: Ciclo de vida do S. mansoni. Dentro do seu hospedeiro vertebrado, as formas larvais (esquistossômulo,A) dão origem a parasitos sexualmente maduros (verme adulto,B), os quais se acasalam e produzem ovos (C) que são liberados para o meio aquático. Os ovos eclodem e liberam os miracídios (D), que penetram nos caramujos, dando origem a numerosos esporocistos (E). Os esporocistos geram cercárias (F) que saem do caramujo e 7

(37) INTRODUÇÃO são liberadas na água, as quais são as formas infectantes para o hospedeiro vertebrado (Verjovski-Almeida et al., 2003). I.3 Genômica e Transcriptômica de S. mansoni Os primeiros estudos envolvendo o genoma de S. mansoni foram realizados por Simpson em 1982. Ele estimou o tamanho do genoma haplóide do parasito em aproximadamente 2.7 × 108 pares de bases e a porcentagem de sequências repetitivas no genoma em aproximadamente 40% do total (Simpson et al., 1982). Somando esforços para o entendimento do genoma do parasito, Le Paslier construiu uma biblioteca de fragmentos genômicos em vetores BAC para a elucidação de sequências genômicas e aplicação de técnicas de hibridização (Le Paslier et al., 2000). Até o final de 2003 nenhum projeto em larga escala envolvendo análise do genoma ou transcriptoma tinham sido executados para Platelmintos e menos de 20.000 etiquetas de sequências expressas (ESTs), representando genes do parasito S. mansoni, tinham sido obtidas (Franco et al., 1995; Franco et al., 1997; Rabelo et al., 1997; Franco et al., 2000). No entanto, no final de 2003, um projeto em larga escala liderado pelas agências FAPESP e CNPq permitiram a obtenção de 200.000 sequências que foram agrupadas em 30.000 contigs (conjuntos não redundantes de sequências expressas) e tornadas públicas através do projeto “S. mansoni EST Genome” (Verjovski-Almeida et al., 2003). Foram estimados 14000 genes neste conjunto de dados apresentando diversos padrões de expressão nas diferentes fases do parasito (Verjovski-Almeida et al., 2003). Em 2009, o Wellcome Trust Sanger Institute e o TIGR finalizaram a montagem do genoma do S. mansoni sem seu completo fechamento. Estes dados estão disponíveis no website do banco de dados GeneDB (http://www.genedb.org) e no NCBI (http://www.ncbi.nih.gov) (Berriman et al., 2009). O genoma do S. mansoni compreende 363 mega bases, distribuídos em oito pares de cromossomos, sendo sete pares autossômicos e um par sexual. O sexo heterogamético no parasito é a fêmea (ZW), enquanto o macho é homogamético (ZZ) (Short and Menzel, 1960; Short et al., 1979; Berriman et al., 2009). Foram estimados 11890 genes, com um tamanho médio de 4,7 kb, apresentando regiões intrônicas de tamanho bastante variável. As análises de genômica comparada em larga escala sugerem que este arranjo gênico é específico de S. mansoni. A discrepância nos tamanhos dos íntrons ainda é pouco entendida, mas sugere um controle transcricional distinto. Vale à pena ressaltar que, este conjunto de 11890 genes representa o repertório gênico de seis estágios de vida do parasito. Desta maneira, sua análise 8

(38) INTRODUÇÃO não se restringe a apenas um estágio de vida refletindo toda complexidade do parasito (Berriman et al., 2009). Outra característica do genoma de S. mansoni é o grande número de elementos repetitivos que somam aproximadamente 40 %. Apesar de até o momento não ser conhecida o impacto desses elementos na biologia do parasito, este percentual tem dificultado o fechamento do genoma gerando fragmentação em scaffolds. Este percentual está bem próximo do encontrado no genoma de seres humanos onde se estima que mais de dois terços do genoma sejam elementos repetitivos (de Koning et al., 2011). Atualmente, o genoma de S. mansoni está fragmentado em 885 scaffolds depositados no genoma versão 5.0 do GeneDB. Esta nova versão do banco de dados disponibiliza uma classificação funcional dos transcritos preditos e sequenciados pelo Gene Ontology (GO). Esta representação gênica confirma a presença de genes associados e/ou homólogos a eucariotos e processos específicos dos metazoários, como diferenciação eixo anterior-posterior, dorso-ventral, epitélio, processo neural, mobilidade, diferenciação sexual, maturação, longevidade, parasitismo, evasão imune e resposta ao estresse. Atualmente, com a disponibilidade de quase 200.000 ESTs, aliado ao projeto genoma do S. mansoni, em fase final de conclusão, o Schistosoma integra-se à categoria dos organismos com os quais se podem utilizar técnicas modernas para, por exemplo, identificar genes estágios-específicos, avaliação global dos efeitos causados por drogas sobre o metabolismo do parasita, entre outros (Oliveira et al., 2008; Berriman et al., 2009). Neste contexto, surge a possibilidade do estudo dos transcritos nas diferentes fases de ovos, cercária, miracídio, esquistossômulos, esporocistos e vermes adultos, permitindo a identificação de genes estágios-específicos bem como as vias de regulação da transcrição envolvidas durante o ciclo biológico deste parasito. I.4 Regulação da expressão gênica em S. mansoni A regulação da expressão gênica em eucariotos compreende processos envolvidos com a síntese e degradação dos RNAs mensageiros direcionando e modulando os caminhos da informação contida no DNA até o produto gênico final. Os processos de controle da expressão gênica ocorrem principalmente ao nível transcricional e pós-transcricional. Os principais mecanismos de controle transcricional estão relacionados com a estrutura da cromatina. Processos como modificação de histonas (acetilação, metilação e deacetilação) e metilação de DNA desempenham um papel essencial no empacotamento de cromatina e 9

(39) INTRODUÇÃO consequentemente no controle da expressão gênica ao nível transcricional (Berger, 2007). Processos pós-transcricionais envolvem principalmente interações proteína-RNA e RNARNA desencadeando um arraste na expressão do gene ou sua degradação. Estes processos pós-transcricionais podem envolver adição de cauda poli-A, adição de 5`CAP, splicing, edição do transcrito primário e silenciamento gênico por pequenos RNAs (Keene, 2007). O S. mansoni apresenta um ciclo biológico bastante peculiar, no qual diversas alterações bioquímicas e morfológicas ocorrem no parasito para que ele complete um ciclo biológico. Acredita-se que estas mudanças são adaptações evolutivas desenvolvidas pelo parasito para sobrevivência em distintos ambientes, como na água e interior dos hospedeiros. sendo possível apenas devido a expressão de um conjunto de genes coordenadamente, em cada estágio, a fim de permitir a adaptação do parasito aos seus ambientes. Trabalhos recentes têm mostrado que o perfil de transcritos e a atividade transcricional no parasito S. mansoni modificam significantemente entre seus diferentes estágios (Fitzpatrick et al., 2009). Uma das formas viáveis e de mais fácil alcance para estudar o padrão de expressão gênica é o estudo do transcriptoma. Este tem propiciado a descoberta de novos genes, elaboração de modelos gênicos, desenho de sondas de microarranjos, clonagem de genes de interesse e outras informações pertinentes para o entendimento da biologia da célula (Brindley and Pearce, 2007; Wilson et al., 2007). Plataformas de microarranjos e SAGE (Serial analysis of gene expression) vêm sendo utilizadas extensivamente para analisar o transcriptoma do parasito evidenciando padrões de expressão de genes estágio-específico (DeMarco et al., 2006; Ojopi et al., 2007; Parker-Manuel et al., 2011). A expressão transitória de genes é totalmente dependente das funções e atividades realizadas pelo organismo em determinado estágio de vida. Por exemplo, genes envolvidos com o remodelamento corporal e formação de tegumento externo se mostraram altamente expressos em esquistossômulos (ParkerManuel et al., 2011). De maneira particular, o período de transformação de cercária em esquistossômulo, deve ser ressaltado devido à grande mudança no perfil de expressão gênica representado nesta fase. Durante esse período, ocorrem várias mudanças morfológicas e bioquímicas como perda da cauda, secreção do conteúdo da glândula acetabular, duplicação da bicamada lipídica da superfície, perda do glicocálix, mudança do núcleo heterocromático para eucromático, intolerância à água e às proteínas da via do complemento do sistema imune e redução no catabolismo do piruvato (Ramalho-Pinto et al., 1974; Blanton et al., 1987). Sabese que a diferenciação na composição de proteínas específicas entre esses dois estágios está 10

(40) INTRODUÇÃO relacionada a alterações na regulação da expressão gênica (Han et al., 2009). A figura 4 resume a distribuição dos genes estágios-específicos em S. mansoni. Figura 4: Expressão gênica estágio-específico em S. mansoni. A figura representa os genes altamente expressos estágios-específicos baseados nos projetos transcriptoma do parasito (Han et al., 2009). Em conjunto, a expressão de diferetes repertórios gênicos em distintas fases do parasito sugerem que os mecanismos de regulação da expressão gênica estão presentes em S. mansoni. Neste contexto, na última década, o mecanismo de silenciamento gênico mediado pelo decaimento de RNA mensageiros tem recebido muita atenção, uma vez que este foi demonstrado sua participação em processos de regulação da expressão gênica ao nível póstranscricional (Bartel, 2009). Os mecanismos de silenciamento gênico mediado por pequenos RNAs, que tem como principal exemplo os miRNAs, tem mostrado estreita correlação com controle de genes envolvidos no desenvolvimento de organismos, manutenção da integridade de genoma e diversos processos celulares (Bartel, 2009). Esta característica tem sido 11

(41) INTRODUÇÃO empregada na tecnologia de RNA interferente desvendando soluções para genética reversa, genômica funcional, terapia gênica, desenvolvimento de animais modelo, estudos do comportamento, validação de alvos para novas drogas e o combate a patógenos (Denli and Hannon, 2003; Baum and Craig, 2004). I.5 microRNAs I.5.1 Histórico e Origem Os microRNAs foram descobertos em 1993 por Victor Ambros, Rosalind Lee e Rhonda Feinbaum durante um estudo sobre a participação do gene lin-14 no desenvolvimento do nematódea Caenorhabditis elegans que levou a descoberta de que este gene era regulado por um pequeno RNA, transcrito como um precursor com 61 nucleotídeos a partir do gene lin-4. Este estudo também evidenciou que esta pequena molécula de RNA continha sequências parcialmente complementares à região 3´UTR do mRNA lin-14 e que esta complementaridade era suficiente e necessária para inibir a tradução do mRNA lin-14. (Lee et al., 1993). Esta descoberta permitiu a caracterização de um novo mecanismo de regulação da expressão gênica liderado por pequenos miRNAs maduros de aproximadamente 22 nucleotídeos. Entretanto, somente em 2000, foi descoberto um segundo miRNA, let-7, que reprimia a tradução de lin-41, lin-14, lin28, lin42 e daf12 atuando durante os estágios de desenvolvimento larval do C. elegans (Reinhart et al., 2000). Devido ao papel de ambos miRNAs no controle do desenvolvimento, foram também denominados de pequenos RNAs temporais, ou small temporal RNAs (stRNAs)(Ambros, 2000). Nos últimos anos, o principal papel dos miRNAs tem sido correlacionado com o controle do crescimento celular. Diversos estudos tem mostrado o envolvimento dos miRNAs com o câncer atuando como supressores de tumor ou como oncogenes sendo chamados de oncomirs (Esquela-Kerscher and Slack, 2006; Kozaki et al., 2008; Schmittgen, 2008; Wong et al., 2008). Alguns miRNAs, considerados ongênicos, se apresentam altamente expressos em células malignas estimulando a proliferação celular ou inibindo a ação de genes supressores tumorais. Outros apresentam baixa expressão em tumores malignos provavelmente atuando como supressores tumorais de oncogenes. Como exemplos temos os genes mir-15 e mir-16 que atuam como supressores de tumores induzindo a apoptose e evitando a proliferação celular (Esquela-Kerscher and Slack, 2006). Os miRNAs presentes no 12

(42) INTRODUÇÃO cluster mir-17-92 atuam como oncogenes modulando a formação de tumor por influência na tradução do gene E2F1 (Hayashita et al., 2005). O modelo atual para a biogênese de miRNAs propõe duas etapas: uma intranuclear e uma citoplasmática e encontra-se esquematizada na Figura 5. Na etapa intranuclear os miRNAs podem ser transcritos individualmente por uma RNA polimerase (II principalmente e ocasionalmente III) ou a partir de blocos de sequências genômicas denominadas clusteres (Zhang et al., 2009b). Estes miRNAs se formam a partir de um produto primário complexo, com várias características peculiares, tornando-os reconhecíveis pela maquinaria no meio intranuclear. Geralmente, os pri-miRNAs são processados liberando um intermediário com estrutura secundária em forma de grampo com aproximadamente 60-70 nt, denominado prémiRNA (precursor de miRNA). Esta clivagem é realizada por um micro complexo liderado pela enzima RNase III Drosha, que cliva ambas as fitas do pri-miRNA em sítios próximos à base da estrutura em forma de grampo, gerando um pré-miRNA (Lee et al., 2003). A seguir, o pré-miRNA é transportado de forma ativa, com gasto de GTP, do núcleo para o citoplasma, pelo complexo Ran-GTP/Exportina-5. Para tal transporte, têm sido relatadas duas proteínas responsáveis: XPO-5 e XPO-1 (Castanotto et al., 2009; Bussing et al., 2010). A direção deste transporte, geralmente, é unidirecional, sempre do núcleo para o citoplasma. Recentemente, foi sugerida a participação da proteína XPO-1 no transporte também de miRNAs em D. melanogaster e C. elegans, no sentido inverso, do citoplasma para o núcleo (Castanotto et al., 2009; Bussing et al., 2010). O pré-miRNA, após o transporte para o citoplasma, é processado pela enzima Dicer, juntamente com uma proteína ligante de RNA fita dupla, que em D. melanogaster é chamada Loquacious e R2D2, e em C. elegans, R3D1 (Saito et al., 2005). De acordo com este modelo, a especificidade da primeira clivagem determina a posição correta da segunda clivagem do pré-miRNA, definindo assim, ambas as extremidades do miRNA (Lee et al., 2003). Estes processos de clivagem executados por proteínas da classe RNAse III são facilitados por proteínas acessórias. A atuação destas proteínas acontece conjuntamente com a proteína RNAseIII Drosha, para clivagem nuclear, e RNAseIII Dicer, para clivagem citoplasmática (Han et al., 2006; Winter et al., 2009). Estudos anteriores têm demonstrado a participação essencial destas proteínas auxiliares na biogênese dos miRNAs nas células (Denli et al., 2004; Leuschner et al., 2005; Saito et al., 2005). Ambas as proteínas, partnerDrosha e partner-Dicer, invariavelmente, possuem um domínio conservado com função e característica de ligação em pequenos RNAs. Após esta clivagem, o miRNA maduro é apresentado para o complexo de silenciamento mediado por RNA, denominado mi-RISC. 13

(43) INTRODUÇÃO Inicialmente, os miRNAs foram encontrados em associação com um complexo ribonucleoprotéico denominado miRNP (miRNA ribonuclein complex), que em humanos inclui a proteína Ago1, a helicase GEMIN3 e GEMIN4 e em D. melanogaster inclui a Ago1, Fmr1, Tudor-SN e VIG (Mourelatos et al., 2002; Meister and Tuschl, 2004). Desta forma, foi sugerido que o complexo miRNP corresponde ao RISC, que direciona a clivagem de mRNAs no mecanismo de silenciamento de RNA por meio do decapeamento e retirada da cauda de poli-A. Uma vez incorporado ao RISC, o miRNA vai direcionar a clivagem específica de mRNAs complementares ou reprimir sua tradução em corpos citoplasmáticos chamados corpos P (Meister and Tuschl, 2004; Naqvi et al., 2009) (Figura 5). miRNAs em animais, geralmente, atuam como repressores da tradução de determinados genes por pareamento não perfeito na região 3`UTR, embora, outros estudos tem mostrado sítios funcionais em regiões codificadoras e/ou regiões 5`UTR (Lai, 2002; Lytle et al., 2007). Vale a pena ressaltar que, recentemente, foi descrita uma via alternativa de processamento de miRNA à partir de regiões intrônicas. Este miRNAs, denominados mirtrons, são processados diretamente a pré-miRNAs pela maquinaria de splicing evitando a primeira passagem pelo complexo enzimático comandado pela proteína RNAseIII Drosha (Westholm and Lai, 2011). Posteriormente o processamento do miRNA de origem intrônica segue a mesma via descrita acima e ilustrada pela Figura 5. Figura 5: Mecanismo de silenciamento gênico mediada por miRNAs. O mecanismo de silenciamento gênico mediada por miRNA ocorre em dois passos distintos: um nuclear (a, b, c) e outro citoplasmático, sendo finalizada quando uma das fitas do duplex encontra mi-RISC e seu respectivo mRNA alvo (d, e, f). (Adaptado de (Naqvi et al., 2009). 14

(44) INTRODUÇÃO I.5.2 Estratégias de Predição e Validação de miRNAs A descoberta dos miRNAs, seja por estratégias computacionais ou experimentais, não tem sido considerada uma tarefa fácil trazendo vários problemas associados. Os problemas dirigidos à predição e validação dos miRNAs, a partir de sequências genômicas e/ou transcriptômicas, tem como exemplos: a presença de RNA não codificadores de proteínas com características semelhantes aos miRNAs, posição e orientação não conservada dos miRNAs no genoma, tamanho pequeno das sequências maduras e precursoras, baixa expressão relativa em alguns organismos ou estágios de vida, presença de miRNAs estágio ou espécie específicos, entre outros. Devido a este grande número de fatores, a construção de metodologias robustas e específicas (às vezes organismo-específico) se torna necessária, tanto para predição e validação dos miRNAs quanto para seus alvos. O número de genes que codificam miRNAs inicialmente foram subestimados em menos de 1% do número total de genes (Lim et al., 2003). Em trabalhos posteriores, este número cresceu exponencialmente tornando esta classe de RNA uma das maiores classes de moléculas regulatórias em animais (Berezikov et al., 2005). Atualmente, C. elegans e D. melanogaster, possuem mais de 200 genes que codificam miRNAs, enquanto seres humanos possuem aproximadamente 1500 genes (miRBase versão 18.0 – outubro 2011). A busca e identificação de miRNAs baseados em abordagens experimentais tem sido um desafio para comunidade científica (Huttenhofer and Vogel, 2006). As técnicas mais comuns utilizadas para identificação de sequências de DNA ou RNA são limitadas para este tipo de molécula (Winter and Diederichs, 2011). A clonagem direta, usualmente, não detecta miRNAs com um nível de expressão muito baixo ou miRNAs que são expressos apenas em determinado estágio ou tipo celular (Li et al., 2010a). O sequenciamento de nova geração é capaz de detectar sequências com expressão relativamente baixa, mas requer uma exaustiva análise para distinguir tais moléculas, de outros RNAs não codificadores com tamanho semelhante (Friedlander et al., 2008). Tais estratégias têm sido suplementadas com análises in silico permitindo uma predição mais eficaz e passível de posterior validação (Li et al., 2010a). Estratégias computacionais, criadas para predição de miRNAs, baseiam-se em características específicas destas moléculas, já que os métodos convencionais de busca são ineficazes para tal predição (Wang et al., 2005; Mendes et al., 2009). As abordagens utilizadas para identificação de miRNAs em animais e vegetais são diferentes devido as características dos miRNAs serem distintas nos dois reinos (Zhang et al., 2006b). Assim, critérios de anotação geral de miRNAs tem sido utilizados inspirando diversos programas de 15

(45) INTRODUÇÃO predição de miRNAs baseados na utilização de filtros (específicos de características dos miRNAs), aprendizado de máquinas, homologia ou ab initio. Os métodos baseados em filtros circundam um número diverso de características aplicadas para moléculas de miRNAs diferenciando-as de outros tipos de moléculas no genoma. Dentre estas características, as denominadas estruturais e termodinâmicas, são as mais utilizadas para tal predição. Exemplos destas características são: conteúdo de GC na sequência do pré-miRNA, energia mínima livre da estrutura secundária do precursor de miRNA, localização da molécula precursora no genoma, conservação evolutiva da região madura, etc. Entre os programas que utilizam estas características para predição estão miRScan, MIRSCANII, MIRSEEKER, entre outros (Lai et al., 2003; Lim et al., 2003). Outra abordagem, bastante empregada para identificação de miRNAs, é o treinamento de aprendizado de máquina. Este método utiliza informações de grupos de sequências provindas de miRNAs reais e de grupos de sequências genômicas randômicas não composta por miRNAs utilizadas para o treinamento das máquinas no reconhecimento destas classes distintas. Assim, os candidatos a miRNAs são comparados aos grupos de sequências e uma probabilidade é aplicada classificando-os entre miRNA real ou miRNA não real. Exemplos de aprendizado de máquina utilizados são: MiRFinder, MiPred, MIRCOS, dentre outros (Huang et al., 2007; Jiang et al., 2007; Sheng et al., 2007). A identificação computacional, no entanto, não é suficiente para a caracterização da molécula de miRNA como um produto biologicamente ativo nos seres vivos. Com isso, estratégias utilizam uma combinação de métodos computacionais e métodos experimentais no intuito de identificar e validar esta classe de RNAs (Berezikov et al., 2006). Estas estratégias possuem duas abordagens principais: predição de prováveis miRNAs utilizando análise computacional com posterior validação experimental e clonagem/sequenciamento com posterior localização no genoma avaliando as características estruturais e termodinâmicas das sequências. Estas duas abordagens aumentam o número de sequências de miRNAs consideradas reais nos bancos de dados diminuindo os falsos positivos. Estas estratégias tem sido utilizadas, por exemplo, pelo programa PalGrade que identificou milhares de prováveis sequências referentes a miRNAs conservados e não conservados (Bentwich et al., 2005). Posteriormente, estas foram testadas por microarranjos e os sinais positivos foram clonados e sequenciados para identificação dos miRNAs reais. Este método aumentou o número de miRNAs reais identificados em humanos (Bentwich et al., 2005). Neste mesmo contexto, outro método bastante utilizado tem sido o miRDeep. Este método parte de sequências provindas do sequenciamento de RNA com posterior utilização de filtros baseados em 16

(46) INTRODUÇÃO características conservadas de miRNAs reais para validação das moléculas (Friedlander et al., 2008). I.5.3 Estratégias de Predição de Alvos de miRNAs A identificação computacional de alvos de miRNAs e a validação de suas interações, constituem etapas fundamentais na descoberta das funções celulares dos miRNAs. A medida da função do miRNA é baseada estritamente nos alvos no qual ele silencia, ou seja, aqueles potencialmente afetados na expressão gênica diretamente. O silenciamento gênico mediado por miRNAs tem sido descrito baseado na clivagem do mRNA alvo ou na repressão de sua tradução em proteína (Bartel, 2009). O primeiro ocorre preferencialmente em plantas e o segundo preferencialmente em animais (Eulalio et al., 2008; Voinnet, 2009), correlacionado algumas vezes, com o seqüestro e transferência da maquinaria de silenciamento gênico mediada por miRNAs para compartimentos sub-celulares denominados corpos P (Liu et al., 2005). O silenciamento gênico mediado por miRNAs em animais tem focado diretamente no pareamento desta molécula com regiões 3`UTRs dos alvos. No entanto, estudos recentes tem dado atenção também para regiões codificadoras de proteínas e regiões 5`UTRs (Lytle et al., 2007). O pareamento realizado pelo par miRNA/mRNA (3`UTR) em animais não ocorre de forma perfeita, ou seja, existem considerações como despareamento entre nucleotídeos e pareamentos não Watson e Crick como G:U (Lewis et al., 2003). O pareamento miRNA/alvo tem sido considerado mais próximo do real quando a região 5` do miRNA maduro, entre os nucleotídeos 2 e 8 (região seed), obtêm uma complementaridade perfeita (100%) com a região 3`UTR do gene alvo (Lewis et al., 2005). Estudos experimentais têm reforçado a necessidade da presença destes sítios complementares na região seed denominando-os de sítios alvos canônicos. Existem também outros sítios não canônicos que possuem certa complementaridade com a região 3` do miRNA, sendo estes chamados de sítios compensatórios não canônicos (Sethupathy et al., 2006b; Grimson et al., 2007). O emprego de diferentes algoritmos computacionais tem sido utilizado para predição e identificação de miRNAs e seus prováveis alvos em diversos organismos (Jones-Rhoades and Bartel, 2004; Wang and El Naqa, 2008). Estes métodos tem se baseado em características específicas envolvendo o processo de interação entre o par miRNA/alvo. Exemplos destas características são: conteúdo de nucleotídeos da região seed, estabilidade termodinâmica do par miRNA/mRNA, conservação evolutiva do sítios de interação e presença de sítios 17

(47) INTRODUÇÃO múltiplos na mesma sequência 3’UTR (Grimson et al., 2007; Kertesz et al., 2007). Vários métodos têm sido desenvolvidos baseados nestas características. Devido à possibilidade de especificidade destas características programas exclusivos para espécies e determinadas situações tem sido desenvolvidos. O programa TargetScan foi um dos primeiros programas a se basear na complementaridade da região seed e na conservação do pareamento miRNA/mRNA para predição de alvos de miRNAs. A estratégia inicial, deste programa, utilizou sequências 3`UTRs de genes de mamíferos para predição de alvos mais confiáveis em H. sapiens. Atualmente, novas versões específicas deste mesmo algoritmo tem sido apresentadas como TargetScanHuman 5.2 (humanos), TargetScanMouse (camundongos), TargetScanFly (D. melanogaster) e TargetScanWorm (C. elegans). Cada um destes programas prediz alvos conservados de determinadas espécies baseados em informações de um grupo de organismo próximo evolutivamente. Existem outros programas que permitem a predição dos alvos de miRNAs com uma flexibilidade maior. Por exemplo, os programas miRAnda (http://www.microrna.org/microrna/home.do), RNAhybrid (http://bibiserv.techfak.uni-bielefeld.de/rnahybrid/) e rna22 tem sido utilizados para predição de alvos de miRNA (Enright et al., 2003; Kruger and Rehmsmeier, 2006). O programa miRANDA, tem sido um dos programas de predição mais utilizados ultimamente. Como principal característica, este programa busca complementaridades significativas no pareamento do par miRNA/mRNA principalmente na região 5` seed do miRNA maduro (Enright et al., 2003). O programa RNAhybrid explora a termodinâmica do par miRNA/mRNA buscando energia mínima livre de pareamento significantes ou estáveis (Kruger and Rehmsmeier, 2006). Além destes programas, muitos outros algoritmos, alguns disponibilizados na web, têm combinado a predição gênica de alvos com outras informações como expressão gênica em diferentes tecidos e organismos, anotação funcional do gene e vias metabólicas (KEGG) e alguns bancos de dados (Ensembl, Swiss-Prot, UCSC) (Nam et al., 2008; Hausser et al., 2009; Roubelakis et al., 2009; Xiao et al., 2009). Estas ferramentas ampliam as informações relevantes sobre o silenciamento gênico mediado por miRNAs e seus prováveis efeitos biológicos nas células. 18

(48) OBJETIVOS CAPÍTULO II Objetivos 19

(49) OBJETIVOS II.1 Geral Identificar e analisar a participação da via de silenciamento gênico mediada por miRNAs no desenvolvimento do parasito S. mansoni utilizando abordagens computacionais e experimentais validando miRNAs, seus alvos e os genes envolvidos na sua biogênese. II. 2 Específicos  Buscar e caracterizar, através de uma análise in silico, genes envolvidos na via de silenciamento gênico mediada por miRNAs utilizando dados de genoma e transcriptoma do parasito S. mansoni;  Desenvolver um algoritmo otimizado para busca e caracterização de miRNAs e seus precursores (conservados e não conservados) utilizando dados de genoma e transcriptoma de S. mansoni;  Desenvolver um algoritmo otimizado para busca e caracterização do cluster mir-71/2 (conservado em S. mansoni) nos genomas de espécies de Protostômios;  Analisar a expressão dos genes envolvidos na biogênese de miRNAs em diferentes fases de desenvolvimento de S. mansoni avaliando a participação de mecanismos póstranscricionais no parasito;  Predição e validação de alvos de miRNAs no genoma de S. mansoni;  Analisar a expressão dos miRNAs maduros sma-mir-125a e sma-mir-124-3p (conservados) e seus prováveis alvos conservados (inexina e sinoviolina) em diferentes fases de desenvolvimento de S. mansoni avaliando a participação de mecanismos pós-transcricionais no parasito. 20

(50) Via de silenciamento gênico mediada por miRNAs em S. mansoni Capítulo III Via de silenciamento gênico mediada por miRNAs em S. mansoni 21

(51) Via de silenciamento gênico mediada por miRNAs em S. mansoni III.1 Justificativa A via de silenciamento gênico mediada por miRNAs tem sido descrita em diversos organismos modelos como D. melanogaster, C. elegans e H. sapiens (Ambros, 2003; Lee et al., 2004; Azuma-Mukai et al., 2008). Vários estudos têm mostrado a conservação desta maquinaria, desde organismos inferiores até organismos multicelulares como seres humanos (Murphy et al., 2008; Lee et al., 2010). No entanto, a descoberta da participação desta via em novas funções do organismo tem expandido sua complexidade, assim como o número de genes envolvidos nela. Membros desta via como Argonauta e Dicer têm sido relatados em espécies do gênero Schistosoma incluindo S. mansoni e S. japonicum (Krautz-Peterson and Skelly, 2008; Gomes et al., 2009; Luo et al., 2010). Uma análise preliminar dos genes envolvidos na via de biogênese de miRNAs em S. mansoni foi publicada por nosso grupo de trabalho, em 2009, mostrando uma expressão diferencial dos genes centrais da via, SmArgonauta e SmDicer, em diferentes etapas do ciclo de vida do parasito (Gomes et al., 2009). Visto a importância destes genes na regulação da expressão gênica, influenciando diversos mecanismos celulares, tornou-se necessário um estudo mais detalhado dos genes desta maquinaria no parasito S. mansoni, abordando os seguintes temas: identificação computacional e distribuição cromossômica dos genes da maquinaria; conservação filogenética, análise dos domínios conservados e predição de estruturas secundárias e terciárias das proteínas preditas da via; e análise da expressão gênica dos seus transcritos em diversas fases de desenvolvimento do parasito S. mansoni. 22

(52) Via de silenciamento gênico mediada por miRNAs em S. mansoni III.2 Materiais e Métodos III.2.1 Validação in silico III.2.1.1 Análise e localização da via de miRNA no genoma de S. mansoni As sequências das prováveis proteínas envolvidos na via de miRNA em S. mansoni foram preditas utilizando a ferramenta Blastp disponibilizada no banco de dados de S. mansoni (GeneDB http://www.genedb.org/genedb/smansoni/)(Berriman et al., 2009). Como sequências de busca foram utilizadas sequências de aminoácidos das proteínas envolvidas na via de miRNA em organismos modelos como D. melanogaster. C. elegans e H. sapiens. Prováveis genes ortólogos foram recuperados do banco de dados do NCBI (National Center for Biotechnology Information - http://www.ncbi.nlm.nih.gov/) e utilizados posteriormente para análises comparativas de sequência. As sequências dos genes foram localizadas no genoma do parasito utilizando informações provenientes dos arquivos de anotação disponível no banco de dados do parasito e um script escrito em PERL para busca das posições dos resíduos de nucleotídeos no genoma. III.2.1.2 Alinhamento múltiplo de sequências e Análise filogenética As sequências preditas de aminoácidos das prováveis proteínas envolvidas na via de miRNAs em S. mansoni foram submetidas a busca por famílias de domínios e motivos conservados utilizando o banco de dados de família de proteínas PFAM versão 25.0 (Protein family database - http://pfam.sanger.ac.uk/)(Finn et al., 2010). Estas sequências foram também submetidas à análise comparativa com suas prováveis proteínas ortólogas. Foi utilizado como programa para obtenção dos alinhamentos múltiplos de sequência o programa ClustalX 2.0 realizado com parâmetros default(Larkin et al., 2007). As análises filogenéticas comparativas foram empregadas utilizando as sequências das proteínas preditas de S. mansoni e os possíveis ortólogos de referência (RefSeq) encontrados em outras espécies e conduzidos utilizando o programa MEGA 4(Tamura et al., 2007). As árvores filogenéticas foram inferidas utilizando o método Neighbor-Joining (NJ) (Saitou and Nei, 1987) e calculada com o modelo de substituição JTT. A distância entre os ramos horizontais, separando duas seqüências foram proporcionais a divergência entre as seqüências. A árvore filogenética consenso foi montada utilizando a análise de teste de 23

(53) Via de silenciamento gênico mediada por miRNAs em S. mansoni bootstrap com 2000 réplicas representando a história evolutiva do clado analisado. A porcentagem de réplicas das árvores filogenéticas foi realizada pelo teste de bootstrap apresentando no final apenas a árvore consenso. Todas as posições contendo espaços ou dados perdidos de sequências foram eliminadas do conjunto de dados. A árvore foi desenhada com os tamanhos dos ramos nas mesmas unidades daquelas distâncias utilizadas para inferir a árvore filogenética. III.2.1.3 Análise de resíduos hidrofóbicos (Hydrophobic Cluster Analysis - HCA) A análise dos resíduos de aminoácidos hidrofóbicos foi realizada para proteínas contendo domínio SN (Staphlococcal nuclease) utilizando o programa HCA (Hydrophobic Cluster Analysis) alocado no servidor Mobyle (http://mobyle.rpbs.univ-paris-diderot.fr/cgibin/portal.py?form=HCA). HCA é um método baseado no uso de um gráfico bidimensional para identificação de regiões globulares e não globulares em proteínas contendo regiões de α hélice e/ou folhas beta permitindo a análise de estruturas altamente dissimilares. III.2.1.4 Predição da estrutura secundária A predição da estrutura secundária das proteínas foram realizadas para proteínas contendo domínio SN utilizando o programa PredictProtein (http://www.predictprotein.org). As posições dos aminoácidos contidos nas estruturas α hélice, folhas beta e loops foram mapeadas nas sequências pelo mesmo programa (Rost and Liu, 2003; Rost et al., 2004). III.2.1.5 Predição da estrutura terciária A predição da estrutura terciária de proteínas foi inferida usando um modelo de cálculo teórico SWISS-MODEL para modelagem homóloga (Arnold et al., 2006). Inicialmente a estrutura primária das proteínas identificadas foram buscadas no banco de dados repositório SWISS-MODEL que contem mais de 3 milhões de modelos de proteínas provenientes do banco de dados UniProt(Kiefer et al., 2009). Foi feito um alinhamento entre uma sequência modelo depositada no SWISS-MODEL e a sequência de interesse. Após a comparação, as posições dos átomos do modelo foram medidas. Os modelos foram, assim, ponderados por sua similaridade com a seqüência alvo, enquanto as posições divergentes foram excluídas. O melhor modelo depositado no repositório foi selecionado através de um 24

(54) Via de silenciamento gênico mediada por miRNAs em S. mansoni esquema de pontuação, baseada em diversas características da estrutura 3D como: energia da estrutura, impedimento estérico entre os átomos e interações favoráveis entre resíduos de aminoácidos na estrutura como formação da ligação de hidrogênio entre outras. A reconstrução das cadeias laterais da sequência foi baseada nas posições ponderadas dos resíduos correspondente no modelo (Kiefer et al., 2009). A visualização das estruturas foi obtida utilizando o programa PyMOL (http://www.pymol.org)(Delano, 2002). III.2.2 Validação experimental III.2.2.1 Parasitos Neste trabalho foram utilizados parasitos da espécie S. mansoni linhagem LE, em diferentes etapas do ciclo. Vermes adultos e cercárias, foram cedidos pelo Moluscário do CPqRR/FIOCRUZ (Centro de Pesquisa René Rachou, Fundação Oswaldo Cruz) em Belo Horizonte/MG. Os vermes adultos foram obtidos a partir da perfusão do sistema porta-hepático de camundongos da linhagem Swiss Webster infectados com aproximadamente 100 cercárias por via subcutânea após 50 dias, conforme descrito por Smithers e Terry (1965) (Smithers and Terry, 1965; Basch, 1981). Após a coleta, os vermes adultos foram armazenados em tubo de 1,5 ml a -80ºC para posterior utilização. As cercárias foram obtidas após 27 a 31 dias de infecção do hospedeiro intermediário Biomphalaria glabrata com miracídeos. Posteriormente a cercária, foi separada do sobrenadante e das impurezas contidas no meio e armazenada em tubos de 1,5 ml a -80ºC para posterior utilização. Os esquistossômulos mecanicamente transformados foram obtidos através da forma larval cercária. Inicialmente, as cercárias frescas após banho de gelo (2 horas) e separação das impurezas por sedimentação, foram transferidas para tubos falcons de 15 mL. Cada tubo foi separado com aproximadamente 200.000 cercárias e 5 mL de RPMI 1640 (INVITROGEN). Após a ruptura mecânica da cauda e do corpo cercariano todo volume foi adicionado a um novo recipiente e adicionado RPMI suplementado com 10% de penicilina / estreptomicina100 mg/mL. O recipiente foi cuidadosamente incubado em estufa de CO2 5% a 37C por 3 horas e meia para inversão metabólica e transformação do fase de cercária em esquistossômulos (Harrop and Wilson, 1993). Posteriormente o corpo cercariano foi separado 25

(55) Via de silenciamento gênico mediada por miRNAs em S. mansoni da cauda em fluxo laminar por sedimentação eliminando a cada 60 segundos o sobrenadante de meio de cultura contendo caudas. Após verificado a presença apenas de corpo cercariano o material foi dividido em vários frascos de 1,5 mL. O corpo cercariano neste estágio já pode ser considerado esquistossomulo já que dispendeu tempo necessário ma estufa para inversão metabólica. Os esquistossomulos referentes a cada estagio de incubação, aproximadamente 800 esquistossômulo por mL, foi realizado em meio 169 (Tabela 2) suplementado com 10% de soro fetal bovino (Gibco) e 1% penicilina / estreptomicina100 mg/mL por poço(Basch, 1981). Tabela 2- Meio 169 com seus componentes e concentração. Componentes Concentração Hidrolisado de lactoalbumina 0,1% Glicose 0,1% Hipoxantina 5 X 10-7M Triiodotironina (T3) 2 X10-7M Serotonina 1 X 10-6M Hidrocortisona 1 X 10-6M Meio Mínimo Vitamina 0,5% Meio Schneider 5% HEPES 20 mM RPMI q.s.p. 500 mL Os esquistossômulos mecanicamente transformados foram cultivados durante 3,5 horas, 24 horas, 48 horas, 72 horas, 5 dias e 7 dias (EMT-3,5 horas, EMT-24 horas, EMT-48 horas, EMT-72 horas, EMT-5 dias, EMT-7 dias). A Figura 6 ilustra uma preparação com 24 horas de cultivo in vitro. Figura 6: Preparação de esquistossômulos de 24 horas. Os esquistossômulos foram cultivados por 24 horas em estufa de CO2 5% a 37ºC em meio 169. 26

(56) Via de silenciamento gênico mediada por miRNAs em S. mansoni III.2.2.2 Análise da expressão gênica por qRT-PCR III.2.2.2.1 Extração do RNA total Cerca de 50-100 mg de vermes adultos, 100.000-200.000 cercárias, 100.000-200.000 esquistossômulos de 3,5 horas, 24 horas, 48 horas, 72 horas, 5 dias e 7 dias foram utilizados para extração de RNA total utilizando o kit RNA total (SV total RNA Isolation System PromegaTM) seguindo o protocolo do fabricante. A amostra biológica foi homogeneizada em 1 mL de TRIzol® Reagent (InvitrogenTM) com auxílio de um homogeneizador tipo politron. Posteriormente, o homogeneizado foi transferido para tubos eppendorf de 1,5 mL e incubado por 5 minutos à temperatura ambiente para permitir a completa dissociação dos complexos de nucleoproteínas. A seguir foram adicionados 0,2 mL de clorofórmio (Sigma - St. Louis, MO, USA) para cada 1,0mL de TRIzol. A mistura foi homogeneizada vigorosamente com auxílio de um vórtex. Posteriormente, as amostras foram centrifugadas por 12 minutos a 12.000g a temperatura ambiente. A fase aquosa foi transferida para um novo tubo seguido da adição de volume equivalente de etanol 95% v/v (preparado com água livre de RNAses) e homogeneizado suavemente por inversão o tubo, por três vezes, para a precipitação do RNA. A seguir o RNA total foi purificado com o kit SVRNA System conforme instrução do boletim técnico. A qualidade das preparações foi avaliada em gel de agarose/formaldeído, como mostra a Figura 7. A pureza e quantificação dos RNAs foram determinadas utilizando o aparelho NanoDrop (GE) avaliando as relações entre os comprimentos de onda 260nm/280nm e 260nm/230nm indicativos de pureza do amostra. 27

(57) Via de silenciamento gênico mediada por miRNAs em S. mansoni Figura 7: Análise em gel de agarose/formaldeído a 1%.O RNA total foi obtido utilizando o kit SV40 a partir de vermes adultos (1), cercárias (2), esquistossômulos de 3,5 horas (3); esquistossômulos de 24 horas (4); esquistossômulos de 48 horas(5); esquistossômulos de 72 horas (6); esquistossômulos de 5 dias (7) e esquistossômulos de 7 dias (8). III.2.2.2.2 Oligonucleotídeos iniciadores (Primers) Os oligonucleotídeos iniciadores específicos para os genes em estudo foram idealizados utilizando o programa Gene Runner. Estes foram baseados nas sequências de cDNA depositadas no bancos de dados GeneDB. III.2.2.2.3 RT-PCR A primeira fita do cDNA foi sintetizada utilizando 1 g de RNA total extraído e o Kit High Capacity RT-PCR System (Applied Biosystems), seguindo as recomendações dadas pelo fabricante. Brevemente, pipetou-se em um mesmo tubo eppendorf de 1,5ml, 2 µL de tampão da reação, 2µL de primers randômicos, 10 mM de dNTPs, 1,0 µL de Transcriptase reversa Multiscribe, 1 µL de inibidor de RNAse e água livre de nuclease para um volume final de 10 L. Adicionou-se a esta mistura 10 µL de RNA total, volume correspondente a 1 µg de RNA extraído. Cuidadosamente, homogeneizou-se o tubo pipetando para cima e para baixo 2 vezes para completa mistura do RNA total na mistura. Posteriormente, o tubo contendo a mistura de reagentes e o RNA total foi incubado em termociclador (Thermo Hybaid Px2) seguindo o seguinte programa: 10 minutos a 25º C, 120 minutos a 37º C para produção da primeira fita de DNA (cDNA), 85C por 5 minutos para inativação da enzima RNAseH e por fim 4ºC. A amostra de cDNA foi estocada a -20C até o momento do uso. No intuito de obter o cDNA fita dupla, amplificações foram realizadas utilizando 2L do cDNA como molde, combinados com os mesmos reagentes e etapas de reação descritos no item de DNA genômico, com exceção dos primers por sua especificidade e temperatura de anelamento. III.2.2.2.4 PCR quantitativa em Tempo Real (qRT-PCR) Para análise da expressão dos genes em estudo foi utilizada a técnica de PCR quantitativa em tempo real. As reações foram realizadas utilizando o kit Platinum SYBR green qPCR SuperMix-UDG ROX (Applied Biosystems), utilizando 2μL dos iniciadores na 28

(58) Via de silenciamento gênico mediada por miRNAs em S. mansoni concentração de 300 nM, 5μL de SYBR Green, 3μL de cDNA diluído 5x com água livre de DNAse, somando um volume final de 10 μL de reação. Os ensaios foram realizados em triplicata técnica e biológica para todos os genes da via de silenciamento gênico mediada por miRNAs em S. mansoni, com o constitutivo α-tubulina presente na mesma placa que os genes avaliados. Os valores de baseline e threshold utilizados foram ajustados para 3-15 ciclos referente à baseline e de 0,1 para threshold. As análises foram feitas utilizando o método do ∆Ct sendo os resultados expressos na fórmula 2-∆Ct = 2-(Ct Gene alvo - Ct α tubulina). Em relação à expressão, os valores obtidos foram multiplicados por 100 para melhor visualização dos dados no gráfico. A reação de qRT-PCR foi conduzida conforme programação contida no aparelho ABI 7300 Applied Biosystems. III.2.2.2.5 Avaliação da curva de eficiência dos iniciadores Para avaliar a eficiência de amplificação dos iniciadores utilizados, foram construídas curvas utilizando 5 diluições seriadas de 1:4 vezes de uma amostra de cDNA de cercária. O ensaio foi realizado em triplicata e a concentração dos iniciadores foi de 300 nM. Os valores foram plotados em um gráfico onde o eixo X apresentava o Log das concentrações de cDNA e o eixo Y, o valor de CT para cada diluição. Os primers foram considerados adequados para avaliar expressão gênica pelo sistema SYBR™ Green, quando apresentavam eficiência de reação acima de 95% e abaixo de 105% que é determinado pelo slope da curva, aplicado na seguinte formula: Eficiência = [10(-1/slope) - 1] x 100. Os valores de baseline e threshold para os primers utilizados foram ajustados para 3-15 ciclos referentes à baseline e de 0,1 para threshold. Segue abaixo como exemplo, os plot de amplificação e a curva de eficiência referente ao gene α Tubulina. As eficiências de reação dos primers utilizados, bem como, seus respectivos coeficientes de linearidade estão demonstradas na Tabela 3. 29

(59) Via de silenciamento gênico mediada por miRNAs em S. mansoni Figura 8: Plot de amplificação referente à curva de eficiência do α tubulina utilizando diluição seriada de 4x de cDNA de cercária. Em X está demonstrado o valor dos ciclos de PCR e em Y os valor de ∆Rn. Figura 9: Curva padrão referente ao gene α tubulina utilizando diluição seriada de 4x de cDNA. Em X estão demonstrados os valores de Log da concentração de cDNA e em Y os valores de CT correspondes a cada diluição. A direita do gráfico os valores de slope e de coeficiente de linearidade estão representados. III.2.2.2.6 Verificação da qualidade dos amplicons Os produtos amplificados na PCR foram analisados em gel de agarose a 1,2%(90 volts – 75 minutos), juntamente com o padrão de peso molecular 100pb DNA Ladder (Invitrogen) a fim de confirmar presença de uma banda única com peso molecular esperado para os amplificados dos respectivos primers. 30

(60) Via de silenciamento gênico mediada por miRNAs em S. mansoni Tabela 3: Sequência de primers forward e reverse referente aos genes avaliados, tamanho do amplicon gerado, eficiência e R2 dos primers utilizados avaliado através de uma curva de eficiência. Gene SmDrosha1/2 SmFmr1.1 SmPartner-Drosha SmPartner-Dicer SmExportina-5.1/2 SmTudor-SN SmAlfaT Primers F 5’GGGACATTGGCTTGCTTTC3’ R 5’TTGACCTGTTACAGATTGACG3’ F 5’AATGGCTGACTTCTCCTCTG3’ R 5’ACTAATGCGTTTGTTGGG3’ F 5’GATGTTAGTGGTGGTGTTGG3’ R 5’CCTGGCACTTCTTCAACTAG3’ F 5’GTGGTGGTAGCGTGGAAAG3’ R 5’AGAGATTTGCGATTGTGC3’ F 5’CGTCCCTTTATCCGTCAG3’ R 5’CCATCTTGCACCAGTTCTC3’ F 5’ACTTTCGTCGGGAGCATC3’ R 5’CAACACAATGAGCAAGACC3’ F 5’GCAGGATACACAGCAAACTC3’ R 5’TGGTTCTGGGTTCACATC3’ Tamanho do amplicon (bp) 107 Slope R2 -3,23 Eficiência do primer (%) 1,042 0,99918 70 -3,36 0,986 0,99288 101 -3,36 0,984 0,99329 104 -3,43 0,957 0,99265 80 -3,27 1,022 0,99907 79 -3,38 0,977 0,98315 87 -3,39 0,972 0,99982 III.2.2.2.7 Curva de dissociação dos amplicons Foi realizada a curva de dissociação dos amplicons para observar a presença de possíveis amplificações inespecíficas. Ao final dos 40 ciclos da qRT-PCR a temperatura é elevada gradualmente de 60ºC á 95ºC, mantendo-se por 15s em cada temperatura, durante o qual é feito a leitura da emissão de fluorescência. Na medida em que os amplicons desnaturam em temperaturas específicas dependentes do tamanho e número de bases CGAT, o sinal fluorescente emitido pelo SYBR™ Green é reduzido. O gráfico resultante permite verificar se há um ou mais produtos de PCR presentes em cada reação devido a diferenças de temperatura de dissociação. Na Figura 10 está exemplificado uma curva de dissociação referente ao gene SmTudor-SN. Figura 10: Curva de dissociação referente ao amplicon de SmTudor-SN. No eixo x está representado a temperatura de dissociação do amplicon gerado pela reação de PCR e no eixo Y a derivada do valor de emissão de fluorescência. 31

(61) Via de silenciamento gênico mediada por miRNAs em S. mansoni III.2.2.3 Validação dos iniciadores (Sequenciamento) Para avaliar se os iniciadores utilizados (Tabela 3) amplificavam produtos específicos foi realizado PCR convencional utilizando Platinum Taq. A reação de amplificação adotou o seguinte programa: 95ºC por 5 minutos, seguido de 40 ciclos de 95°C por 30 segundos, temperatura de anelamento de cada primer por 30 segundos e 72°C por 30 segundos seguido por um passo adicional após os ciclos de 5 minutos a 72°C. Para isso, foi utilizado 2 µL da 1ª fita de cDNA de cercária diluída 1:5, 1 µL dos iniciadores forward e reverse de cada gene (1 µM) para um volume final de 25 µL da mistura de PCR. A seguir os produtos obtidos foram analisados em gel de agarose a 2 % e comparados com os gerados pela qRT-PCR. A seguir os produtos amplificados foram clonados em pGEM-T easy para posterior seqüenciamento. III.2.2.3.1 Purificação do produto de PCR convencional O produto obtido na reação de PCR convencional foi transferido para um novo tubo tipo eppendorf e adicionado 1/10 do volume inicial de acetato de sódio 3M pH 7,0 (10µL) e 2,5 do volume (250µL) de etanol absoluto. Posteriormente esta mistura foi incubada a -20ºC por 30 minutos e em seguida, centrifugada a 10000 x g por 5 minutos. O precipitado foi lavado com etanol 70% e seco. O DNA foi suspenso em 50 µL de água milli-Q estéril. III.2.2.3.2 Freeze Squeze De acordo com a metodologia descrita por Tautz e Renz (1983) as bandas de interesse, contendo os fragmentos de DNA, foram cortadas do gel de agarose, com auxílio de um estilete. Em seguida, foram transferidas para um becker contendo 10 mL de uma solução composta de NaOAc 300 mM/EDTA 1 mM pH 7,0 e incubada no escuro, sob agitação lenta por 30 min. Posteriormente, as bandas foram transferidas para um tubo contendo um lã de vidro e mantidas a -80ºC por 30 minutos. O DNA livre da agarose foi obtido por centrifugação a 12000 x g por 15 minutos e recuperado a -20ºC pela precipitação com 1/10 de acetato de sódio 3M pH 7,0 e 2,5 volume de etanol absoluto. Após a lavagem com etanol 70% e seco, o DNA foi suspenso em 50 µL de água milli-Q estéril. 32

(62) Via de silenciamento gênico mediada por miRNAs em S. mansoni III.2.2.3.3 Clonagem III.2.2.3.3.1 Reação de Ligação As amostras purificadas foram ligadas ao vetor plasmidial pGEM-T easy (Promega) utilizando 5 µL de tampão, 3 µL do produto de PCR, 1 µL de vetor pGEM-T easy e 1 µL de DNA ligase. A reação foi incubada no termociclador a 4ºC por 16 horas para efetuar a ligação. III.2.2.3.3.2 Preparo de células competentes Uma colônia de células de Escherichia coli DH5α foi inoculadas inicialmente em 5 mL de meio LB (bacto-triptona 10g/L; extrato de levedura 5g/L; NaCl 5g/L; pH=7,5) em um tubo tipo Falcon de 15 mL e incubadas a 37ºC por 16 horas sob agitação de 200 rpm. Após a incubação, 250µL do pré-inóculo foram transferidos para um tubo tipo Falcon de 50 mL e o volume completado para 25 mL com meio SOB (bacto-triptona 2g/L; extrato de levedura 5g/L; NaCl 0,58; KCl 0,2g/L; pH=7,5) suplementado com 250µL de MgSO4 1M e 250µL de MgCl2 1M. A cultura foi incubada por duas horas a 37ºC sob agitação (200 rpm) até que a concentração de células atingisse uma densidade ótica (600nm) entre 0,4 e 0,6. A seguir, as células foram incubadas em banho de gelo por 30 minutos e recuperadas por centrifugação a 3000 x g durante 10 minutos a 4ºC. O sobrenadante foi descartado e o precipitado ressuspenso com auxílio de um pipetador automático em 10 mL de tampão Pipes (60 mM de CaCl2, 10mM de Pipes e 15% de glicerol P.A) para a lavagem das células. As bactérias foram novamente centrifugadas a 2000 x g durante 10 minutos a 4ºC. A lavagem foi repetida duas vezes nas mesmas condições. Após as lavagens, as células foram incubadas por 30 minutos em banho de gelo e em seguida centrifugadas a 2000 x g por 10 minutos a 4ºC. Depois da centrifugação, o sobrenadante foi descartado e o precipitado ressuspenso em 1,2 mL de tampão Pipes. As células competentes foram então aliquotadas e armazenadas a -80ºC até o momento do uso. III.2.2.3.3.3 Transformação Bacteriana 33

(63) Via de silenciamento gênico mediada por miRNAs em S. mansoni Foram adicionados 5µL do produto da reação de ligação em uma alíquota de célula competente (100µL). Essa mistura foi incubada em banho de gelo durante 30 minutos, submetida a choque térmico à 42ºC por 90 segundos e retornada ao banho de gelo em seguida por 2 minutos. Esta foi transferida para um tubo tipo Eppendorf contendo 950µL de meio SOB e incubada durante 90 minutos a uma temperatura de 37ºC sob agitação constante (200 rpm). Após esse período, a suspensão bacteriana foi centrifugada a 3000 x g por 5 minutos e o precipitado transferido para placas de Petri com meio LB-ágar contendo ampicilina (100µg/mL), X-Gal (20µg/mL) e IPTG. A presença de X-Gal permitiu a seleção dos clones recombinantes. As placas contendo as células transformadas foram incubadas durante 16 horas a 37ºC em estufa. III.2.2.3.3.4 PCR de Colônia As colônias recombinantes foram transferidas para 1,5 mL de caldo LB/ampicilina durante 14 horas e submetidas à amplificação por PCR para confirmação da presença do inserto de interesse na colônia. Para realização da PCR de colônia 2µL de cada colônia foi retirada e utilizada como molde de DNA. O mesmo programa da PCR convencional anterior foi utilizado incluindo os primers para extensão do amplicon. III.2.2.3.3.5 Minipreparação Uma alíquota de 20µL da cultura das células transformadas foi colocada em 5 mL de meio LB/ampicilina (100µg/mL) e incubadas durante 16 horas a 37ºC sob agitação constante (200 rpm). O método de extração utilizado foi o da lise alcalina descrito por Maniatis e cols., 1989. III.2.2.3.3.6 Sequenciamento As reações de sequenciamento foram realizadas utilizando o kit Big-Dye Terminator (Applied Biosystems), de acordo com as instruções do fabricante e as reações analisadas no seqüenciador automático de DNA, ABI 3100 Genetic Analyzer (Applied Biosystems). Os plasmídeos foram seqüenciados, nas direções “direta” e “reversa”. O resultado do sequenciamento, em formato fasta, foi inicialmente utilizado para retirada das sequencias dos vetores nas extremidades, processo chamado de trimagem. Após a 34

(64) Via de silenciamento gênico mediada por miRNAs em S. mansoni trimagem, cada sequência foi submetida a ferramenta blastn contra o banco de dados GeneDB e a ferramenta blast2 contra a sequencia utilizada para o desenho dos primers. III.2.2.4 Análise Estatística A expressão relativa nos estágios do parasito foi comparada utilizando a análise da variância por ONE-WAY (Teste de Tukey ou T-Student). Foi considerado estatisticamente significante p<0.05. A análise estatística foi feita utilizando o programa GraphPad Prism 5. 35

(65) Via de silenciamento gênico mediada por miRNAs em S. mansoni III.3 Resultados e Discussão III.3.1 Análise in silico – Via de silenciamento gênico mediada por miRNAs III.3.1.1 Anotação e localização no genoma de S. mansoni Neste trabalho, as proteínas envolvidos na via de silenciamento gênico mediada por miRNA foram identificadas e recuperadas a partir do banco de dados do parasito S. mansoni, GeneDB (www.genedb.org). Foi utilizado como ferramenta Blastp, disponibilizado no próprio banco de dados, e como sequências de busca (“queries”) proteínas da via de miRNAs, provenientes dos organismos modelos C. elegans e D. melanogaster e H. sapiens, onde a via está bem descrita. As prováveis ortólogas encontradas em S. mansoni foram nomeados pelas primeiras letras do nome da espécie, Sm (S. mansoni), seguido pelo nome ou função da proteína ortóloga encontrada nos organismos homólogos. Um número fez parte do nome utilizado quando a proteína apresentou parálogas ou splicing alternativo. A busca dos genes (relativos as proteinas da via) nos cromossomos scaffolds do genoma do parasito foi realizada baseada nos dados dos arquivos GFF disponibilizados no GeneDB utilizando um script Perl. A tabela 4 mostra 13 genes e 18 transcritos relacionados aos constituintes da maquinaria de silenciamento gênico mediada por miRNA em S. mansoni. Todos os genes foram identificados nas sequências genômicas, exceto SmTudor-SN. Pode-se observar que cada gene está localizado em um determinado cromossomo scaffold sendo o cromossomo 1 contemplado com o número maior de genes desta via: SmFMR1.2, SmExportin5.1, SmExportin5.2, SmExportin1.1 e SmExportin1.2. A maioria dos genes da via de miRNA em S. mansoni foi encontrado alocado em cromossomos autossômicos. Apenas os genes SmFMR1.3 e SmFMR1.4 foram encontrados no cromossomo sexual W. Nos cromossomos autossômico 6 e sexual Z não foram encontrados nenhum gene desta via. A critério de comparação, foram realizadas análises semelhantes utilizando o programa MapView (NCBI (http://www.ncbi.nlm.nih.gov/projects/mapview/). Assim foi possível a comparação do cariótipo de genes-referência (RefSeq genes) provenientes da via de silenciamento mediada por miRNA do genoma humano com os genes de S. mansoni. Os resultados sugerem que, assim como em S. mansoni, o gene que codifica a proteína FMR1 em humanos (NP_001172004.1), também está presente em um cromossomo sexual, neste caso, cromossomo X na posição Xq27.3. A distribuição semelhante destes genes, tanto em seres 36

(66) Via de silenciamento gênico mediada por miRNAs em S. mansoni humanos quanto em S. mansoni, pode estar relacionada com a conservação de suas prováveis funções nos animais. O gene que codifica a proteína Dicer-1 em humanos foi encontrado no cromossomo 14 enquanto os genes que codificam proteínas Argonautas foram localizados tanto no cromossomo 1 (AGO1, AGO3 e AGO4) quanto no cromossomo 8 (AGO2). A distribuição dos genes desta via no genoma não apresentou um padrão de localização cromossômica, tanto em eucariotos inferiores, como S. mansoni, quanto em superiores, como H. sapiens. Alguns genes identificados no genoma de S. mansoni apresentaram splicing alternativo como os genes SmExportin5.1, SmExportin5.2, SmExportin1.1, SmExportin1.2, SmDrosha1, SmDrosha2, SmAgo3 e SmAgo4. Resultados semelhantes foram descritos em humanos e D. melanogaster, entre outros (Park et al., 2007; Potenza et al., 2010). Um caso particular foi observado para os genes preditos para os membros da família Argonautas de proteínas de S. mansoni: SmAgo2, 3 e 4. Os genes SmAgo3 e 4 apresentaram splicing alternativo localizados no cromossomo scaffold SC_0250, enquanto SmAgo2, foi localizado em outra parte do genoma, próximo de SmAgo3/4 em uma distância inferior a 50 kb, sugerindo uma duplicação gênica ocorrida durante o processo evolutivo. Tem sido sugerido em H. sapiens que os genes que codificam os membros da família Argonauta de proteínas (AGO1, AGO3 e AGO4) são provenientes de duplicações gênicas ocorridas durante o processo evolutivo(Murphy et al., 2008). Além disso, a distribuição filogenética das proteínas preditas, SmAgo2 , SmAgo3 e SmAgo4, mostrou maior proximidade evolutiva entre si quando comparadas à proteína SmAgo1 (Gomes et al., 2009), reforçando a hipótese de que eventos de duplicação gênica e splicing alternativo são os responsáveis pela diversidade de funções e maior especificidade em relação aos seus alvos efetores dos membros da família Argonauta de proteínas em S. mansoni. 37

(67) Via de silenciamento gênico mediada por miRNAs em S. mansoni Tabela 4: Expansão dos genes envolvidos na via de silenciamento gênico mediada por miRNAs no genoma de S. mansoni. Gene da via de miRNA Cromossomo Scaffold GeneDB ID Início do gene (nt) Final do gene (nt) Tamanho do gene (nt) Orientação no genoma NCBI ID (Gene) NCBI ID (Proteína) SmDrosha1 SmDrosha2 SmPartner-Drosha Chr_5 Chr_5 Chr_4 Smp_142510.1 Smp_142510.2 Smp_087220 1170439 1170439 19342536 1217340 1217340 19366177 46901 46901 23641 minus minus minus XM_002575079.1 XM_002575078.1 XM_002569862.1 XP_002575125.1 XP_002575124.1 XP_002569908.1 SmExportin5.1 Chr_1 Smp_152800.1 31710506 31739365 28859 minus XM_002576959.1 XP_002577005.1 SmExportin5.2 Chr_1 Smp_152800.2 31710506 31739365 28859 minus XM_002576960.1 XP_002577006.1 SmExportin1.1 Chr_1 Smp_124820.1 32483304 32494702 11398 minus XM_002571911.1 XP_002571957.1 SmExportin1.2 SmDicer SmPartner-Dicer SmTudor-SN SmTudor-SN (Truncada) SmTudor-SN (Truncada) SmFMR1.1 SmFMR1.2 SmFMR1.3 SmFMR1.4 Chr_1 SC_0235 Chr_3 EST Chr_3.unplaced. SC_0220 Chr_3.unplaced. SC_0220 Chr_2 Chr_1 Chr_W Chr_W Smp_124820.2 Smp_169750 Smp_023670 Sm01663 32483304 69833 21672299 - 32494702 122456 21674717 - 11398 52623 2418 - minus plus minus - XM_002571912.1 XM_002579762.1 XM_002573758.1 - Smp_166110 28613 29939 1326 plus 31932 10290518 1643175 31443272 31443272 38254 10298192 1674852 31450845 31450845 6322 7674 31677 7573 7573 SmAgo1 Chr_7 Smp_081570 Smp_099630 Smp_016050 Smp_058170.1 Smp_058170.2 Smp_198380 (Smp_140010) 5784524 5808166 SmAgo2 SC_0250 Smp_179320 11056 SmAgo3 SC_0250 Smp_102690.2 SmAgo4 SC_0250 Smp_102690.3 Descrição NCBI Tamanho (aminoácidos) 1531 1577 732 XP_002571958.1 XP_002579808.1 XP_002573804.1 - ribonuclease III ribonuclease III hypothetical protein chromosome region maintenance protein 5/exportin chromosome region maintenance protein 5/exportin chromosome region maintenance protein 1/exportin chromosome region maintenance protein 1/exportin dicer-1 tar rna binding protein (trbp) - XM_002569803.1 XP_002569849.1 ebna2 binding protein P100 378 plus minus plus minus minus XM_002569802.1 XM_002580727.1 XM_002573025.1 XM_002577062.1 XM_002577061.1 XP_002569848.1 XP_002580773.1 XP_002573071.1 XP_002577108.1 XP_002577107.1 520 598 777 728 827 23642 minus XM_002574704.1 XP_002574750.1 17561 6505 plus XM_002581032.1 XP_002581078.1 52745 64433 11688 plus XM_002581034.1 XP_002581080.1 52745 64433 11688 plus XM_002581033.1 XP_002581079.1 ebna2 binding protein P100 fragile X related 1 frx1 fragile X related 2 frx2 hypothetical protein hypothetical protein eukaryotic translation initiation factor 2c eukaryotic translation initiation factor 2c eukaryotic translation initiation factor 2c eukaryotic translation initiation factor 2c 38 1286 1021 1051 918 2174 356 1023 876 955 854 924

(68) Via de silenciamento gênico mediada por miRNAs em S. mansoni Os tamanhos das proteínas preditas envolvidas no silenciamento gênico mediado por miRNA em S. mansoni corroboram com os tamanhos das proteínas ortólogas em organismos modelos como D. melanogaster e C. elegans (Tabela 1). É importante evidenciar a presença, não apenas de proteínas provindas de organismos representantes do clado Protostômios, mas também de organismos do clado Deuterostômios, ampliando a importância da conservação destas proteínas preditas em todo reino animal. Por exemplo, as proteínas preditas SmDrosha1 e SmDrosha2 possuem tamanho (resíduos de aminoácidos) de 1531 e 1577, respectivamente. A proteína ortóloga encontrada em D. melanogaster (NP_477436.1) apresentou 1327 resíduos de aminoácidos, enquanto em C. elegans (NP_001122460.1) e humanos (NP_037367.3) 1374 e 1083 resíduos de aminoácidos, respectivamente. As proteínas preditas SmExportin5.1 e SmExportina5.2 apresentaram tamanhos de 1286 e 1021, respectivamente, enquanto as ortólogas encontradas encontrada em humanos (NP_065801.1) e em D. melanogaster (NP_608339) apresentaram 1204 e 1241, respectivamente. A consistência entre os tamanhos das proteínas ortólogas considerando organismos distantes evolutivamente é mais um indicio da conservação desta via e sua importância biológica em diferentes espécies de animais. Em 2009, nosso grupo publicou um trabalho mostrando a distribuição filogenética e conservação de domínios protéicos em duas classes de proteínas centrais da via de silenciamento gênico mediada por miRNAs no parasito S. mansoni: RNAse III (Dicer e Drosha) e Argonautas (Gomes et al., 2009). Outros estudos também têm mostrado a presença destas proteínas no gênero Schistosoma (Krautz-Peterson and Skelly, 2008; Chen et al., 2010; Luo et al., 2010). Uma expressão gênica diferencial dos genes Dicer e Argonautas, foi mostrada por nosso grupo de trabalho e por Kraus-Peterson (2008), em diferentes fases de S. mansoni (cercária, vermes adultos, esquistossômulos e ovos). Desta forma tornou-se necessário investigar detalhadamente as outras proteínas envolvidas na via a fim de entender melhor a maquinaria de silenciamento gênico mediada por miRNAs. Assim, foram realizadas neste trabalho análises filogenéticas e de domínios conservados das proteínas preditas SmExportina5.1, SmExportina5.2, SmPartner-Dicer, SmPartner-Drosha, SmFmr1.1, SmFmr1.2, SmFmr1.3, SmFmr1.4 e SmTudor-SN evidenciando a importância destas no parasito. Posteriormente, a proteína SmTudor-SN foi submetida a uma análise de estrutura terciária e secundária a fim de observar detalhes estruturais correlacionados com proteínas referências com estrutura elucidada previamente. 39

(69) Via de silenciamento gênico mediada por miRNAs em S. mansoni III.3.1.1 Exportinas 1, 5 e T Neste trabalho, foram preditos três genes e cinco transcritos codificadores de membros da família de proteínas Exportinas (XPO5, XPO1 e XPOT) no genoma do parasito S. mansoni (SmExportin5.1, SmExportin5.2, SmExportin1.1, SmExportin1.2 e SmExportinT) (Tabela 4). Tipicamente, o transporte de precursores de miRNAs tem sido executado pela proteína XPO-5 com gasto de GTP. Recentemente, foi sugerida também a participação da proteína XPO-1 no transporte de miRNAs no sentido inverso, do citoplasma para o núcleo (Castanotto et al., 2009; Bussing et al., 2010). Esta evidência foi corroborada em C. elegans, onde foi demonstrado que a depleção da proteína CRM1, homóloga a XPO-1, foi acompanhada de uma grande variação na concentração de miRNAs na célula. Apesar da função exata dos miRNAs maduros dentro do núcleo ainda ser pouco conhecida, XPO-1 foi co-precipitada com proteínas nucleares, assim como Argonautas, sugerindo a participação de miRNAs no remodelamento de cromatina intranuclear (Castanotto et al., 2009). Homólogos de XPO-5, XPO-1 e XPO-t têm sido reportadas em fungos, plantas e animais. Uma exceção entre os animais tem sido relatada em organismos Protostômios como nematóides e artrópodes que perderam durante a evolução uma das três Exportinas (XPO-5 ou XPO-1). Murphy (2008) sugeriu uma especialização das proteínas Exportinas nos organismos Protostômios em virtude da perda evolutiva de uma delas, a fim de manter os processos normais de exportação e importação de RNAs dentro das células. S. mansoni se enquadra no clado de espécies Protostômios, específicamente próximo de espécies Lophotrochozoans. No entanto, foram identificadas no genoma do parasito Protostômios não apenas duas Exportinas, como sugerido por Murphy (2008) mas as três proteínas da classe Exportina: XPO-5 (SmExportin5.1 e SmExportin5.2), XPO-1 (SmExportin1.1 e SmExportin1.2) e XPO-t (SmExportinT). Pela primeira vez tem sido descrito a identificação destas três proteínas XPOs no clado de Protostômios sugerindo uma maior complexidade da via de transporte de RNA não codificadores, incluindo os miRNAs, no parasito S. mansoni. A fim de enfatizar a conservação destas proteínas preditas identificadas em S. mansoni, foram realizados uma análise filogenética e um estudo de domínios conservados. A análise filogenética foi empregada usando proteínas ortólogas previamente identificadas em espécies de Protostômios e Deuterostômios e as anotadas neste trabalho. A análise revelou uma distribuição em três diferentes grandes grupos, um para cada Exportina: XPO-5, XPO-1 e XPO-t (Figura 11). As prováveis proteínas de S. mansoni se agruparam com as respectivas 40

(70) Via de silenciamento gênico mediada por miRNAs em S. mansoni ortólogas próximas de proteínas de Ecdysozoans e Lophotrochozoans como D. melanogaster, C. elegans e S. japonicum. Proteínas que se enquadraram nos grupos XPO-t e XPO-1 se mostraram mais próximas evolutivamente quando comparadas com as respectivas parálogas XPO-5 (Figura 11). Estes resultados corroboram com Murphy (2008) que demonstrou maior proximidade entre as proteínas ortólogas XPO-t e XPO-1 de animais quando comparadas suas parálogas XPO-5(Murphy et al., 2008). Figura 11: Distribuição evolutiva das proteínas XPO5, XPO1 e XPOt. Árvore filogenética consenso baseada na sequências de resíduos de aminoácidos das proteínas XPO5 , XPO1 e XPOT. Para árvore consenso e confiabilidade dos ramos formados foram utilizados testes de bootstrap com 2000 réplicas e mínimo de 50% para cada ramo confiável. A árvore mostrou 3 clados distintos (separado por colchetes) sendo um para cada conjunto de proteínas 41

(71) Via de silenciamento gênico mediada por miRNAs em S. mansoni ortólogas. As proteínas evidenciadas em caixa cinza representam as proteínas identificadas neste trabalho. A construção da árvore e a análise do “bootstrap” foram realizadas no programa MEGA 4.0. A similaridade das Exportinas identificadas em S. mansoni comparadas com suas ortólogas foi também analisada ao nível de conservação de domínios conservados. As proteínas tiveram alto grau de similaridade (XPO5 de S. mansoni e D. melanogaster 8,9e-11 e 1,5e-11, respectivamente) quando comparadas com o domínio conservado consenso XPO1 (PFAM 08389) (Figure 12). Os maiores valores de similaridade com o domínio consenso foram encontrados nas proteínas ortólogas XPO-1. Estes domínios consensos, presentes no banco de dados de famílias de proteínas, PFAM, tem sido considerados representativos, gerando informações valiosas não apenas quanto a posição específica de determinado aminoácido dentro do domínio conservado, mas também com relação aos seus resíduos vizinhos. Neste sentido, a presença do domínio conservado e seus resíduos de aminoácidos em posições definidas na proteína foram considerados relevantes para a determinação da conservação das proteínas analisadas. Observou-se valores muito significativos em relação ao domínio conservado XPO1, para as proteínas preditas SmExportina1.1 (1,8e-40) e SmExportina1.2 (3,6e-38). O mesmo foi encontrado para ortólogas XPO-1 de D. melanogaster, C. elegans e H. sapiens, com valores menores que e-38(Figura 12). Além disso, as disposições dos domínios conservados, das representantes XPO-1 (IBN_N, XPO1 e CRM1_C), XPO-5 (XPO1) e XPO-t (XPO1), revelaram alto grau de similaridade entre as proteínas de S. mansoni identificadas e suas ortólogas em C. elegans, D. melanogaster e H. sapiens (Figura 12). III.3.1.2 Partner de Dicer e Drosha (RNAseIIIs) A busca de prováveis proteínas, partner-Drosha e partner-Dicer, no genoma de S. mansoni foi capaz de identificar uma representante cada, Smpartner-Drosha e SmpartnerDicer. As proteínas partners ou auxiliares de Dicer e Drosha tem sido reportadas como facilitadoras do processo de clivagem dos pri-miRNAs, no núcleo, ou dos pré-miRNAs, no citoplasma (Denli et al., 2004; Leuschner et al., 2005; Saito et al., 2005). Em vertebrados e Protostômios Artrópodes tem sido encontrada uma representante partner-Drosha e duas parálogas de partner-Dicer, PACT (Protein activator of the interferon-induced protein kinase – Proteína ativadora de proteína quinase dependente de interferon) e TRBP (TAR RNAbinding protein – Proteína TAR ligante de RNA) em Vertebrados e R2D2 e Loquacious em 42

(72) Via de silenciamento gênico mediada por miRNAs em S. mansoni Artrópodes. No entanto, o Protostômio Ecdysozoan C. elegans apresentou apenas uma proteína partner-Dicer, denominada RDE-4, e uma partner-Drosha. Figura 12: Conservação evolutiva dos domínios de XPO5, XPO1 e XPOt. As proteínas ortólogas XPO5, XPO1 e XPOt encontradas nos organismos D. melanogaster, C. elegans e 43

(73) Via de silenciamento gênico mediada por miRNAs em S. mansoni H. sapiens e aquelas identificadas no parasito S. mansoni foram comparadas quanto a disposição e presença de domínios conservados na estrutura primária. A descrição de cada domínio, foi representada na estrutura por um polígono indicado no rodapé da Figura juntamente com os números PFAM. O tamanho de cada proteína está indicado no final de cada sequência e os valores comparativos de cada domínio estão indicados a direita de cada sequência. Para avaliar a conservação das proteínas preditas (Tabela 4) de S. mansoni, foram realizados estudos filogenéticos e análise de domínios conservados utilizando proteínas de representantes de espécies de Deuterostômios e Protostômios. A distribuição filogenética destas proteínas revelou uma provável ancestralidade comum entre elas, resultado de uma provável duplicação gênica (Figura 13). Eventos de duplicação gênica tem sido reportada em outras proteínas da via de silenciamento gênico mediada por miRNAs como as proteínas Argonautas, Dicer e FMR1. Além disso, no parasito S. mansoni tem sido também relatado eventos de duplicação gênica durante o processo evolutivo (Lee et al., 2004; Berriman et al., 2009; DeMarco et al., 2010). A árvore filogenética foi realizada utilizando o programa MEGA 4 e como matriz e modelo, Neighbor joining e JTT. Ficou evidente na figura 13 a presença de dois clados distintos, sendo um composto por ortólogas e parálogas de partner-Dicer, e outro composto por ortólogas de partner-Drosha. Tanto a proteína predita SmPartner-Drosha quanto a proteína predita SmPartner-Dicer se agruparam em seus respectivos clados próximos a ortólogas de espécies de Protostômios, como D. melanogaster, C. elegans e S. japonicum. A proteína predita SmPartner-Dicer agrupou-se entre os clados das parálogas de auxiliares de Dicer encontradas em Protostômios Artrópodes (Loquacious e R2D2). Estas duas proteínas, Loquacious e R2D2, auxiliares de Dicer-1 e Dicer-2, respectivamente, estão envolvidas em processos totalmente distintos, compondo complexos ribonucleoproteicos diferentes. As funções destes complexos têm sido caracterizadas mostrando distintas funções nos organismos em que os encontra. Por exemplo, mutações realizadas em proteínas do complexo liderado por Dicer-1 alteram diretamente o processamento de miRNAs, enquanto no complexo liderado por Dicer-2, o pequeno RNA afetado é o siRNA (Lee et al., 2004; Jaskiewicz and Filipowicz, 2008). 44

(74) Via de silenciamento gênico mediada por miRNAs em S. mansoni Figura 13: Distribuição evolutiva das proteínas partner-Drosha e partner-Dicer. A árvore filogenética consenso foi baseada na sequências de resíduos de aminoácidos das proteínas partner-Drosha e partner-Dicer. Para árvore consenso e confiabilidade dos ramos formados foram utilizados testes de bootstrap com 2000 réplicas e mínimo de 30% para cada ramo confiável. A árvore mostrou 2 clados distintos (caixas cinza) sendo um para cada conjunto de proteínas ortólogas. As proteínas evidenciadas em negrito representam as proteínas identificadas neste trabalho. A construção da árvore e a análise do “bootstrap” foram realizadas no programa MEGA 4.0. Os domínios conservados destas proteínas também foram identificados e comparados com as proteínas ortólogas. Ambas as proteínas, partner-Drosha e partner-Dicer, invariavelmente, apresentaram um domínio conservado DSRM (Domínio de ligação ao RNA dupla) com provável função e característica de ligação em pequenos RNAs. Este domínio de 45

(75) Via de silenciamento gênico mediada por miRNAs em S. mansoni ligação de RNA tem sido caracterizado no banco de dados de domínios conservados PFAM como PF00035 apresentando em sua sequência consenso aproximadamente 65-68 resíduos de aminoácidos. A presença do domínio conservado DSRM, em ambas as proteínas partners em S. mansoni (SmPartner-Drosha e SmPartner-Dicer), corroborou com as análises feitas em suas proteínas ortólogas. As proteínas partner-Dicer em D. melanogaster, C. elegans e H. sapiens, apresentaram dois domínios DSRM, completos e/ou incompletos, distribuídos em toda sua estrutura (Figura 14). Esta mesma estrutura foi encontrada para a proteína predita de S. mansoni SmPartner-Dicer. As proteínas SmPartner-Drosha e suas ortólogas em D. melanogaster e C. elegans, apresentaram apenas um domínio DSRM. Já a representante em H. sapiens apresentou dois domínios DSRM. O tamanho das estruturas primárias destas proteínas variou em uma faixa similar. As proteínas partner-Dicer apresentaram tamanhos entre 311 e 465 enquanto as proteínas partner-Drosha apresentaram tamanhos entre 570 e 790 resíduos de aminoácidos. 46

(76) Via de silenciamento gênico mediada por miRNAs em S. mansoni Figura 14: Conservação evolutiva dos domínios de partner-Drosha e partner-Dicer. As proteínas ortólogas partner-Drosha e partner-Dicer encontradas nos organismos D. melanogaster, C. elegans e H. sapiens e aquelas identificadas no parasito S. mansoni foram comparadas quanto a disposição e presença de domínios conservados na estrutura primária. Cada domínio esta representado por uma caixa cinza entre o início e o término dos resíduos de aminoácidos da proteína. O tamanho de cada proteína está indicado no final de cada sequência e os valores comparativos de cada domínio estão indicados a direita de cada sequência. 47

(77) Via de silenciamento gênico mediada por miRNAs em S. mansoni III.3.1.3 FMR1 (Fragile-X mental retardation 1) Neste trabalho, foram identificadas no genoma de S. mansoni, quatro proteínas da família FMRP: SmFMR1.1, SmFMR1.2, SmFMR1.3 e SmFMR1.4. FMRP tem sido encontrada em neurônios e na fenda sináptica associada à polirribossomos e também participando em mecanismos de silenciamento gênico mediada por miRNAs (Bassell and Warren, 2008). O número de componentes da família FMRP varia entre espécies de Deuterostômios e Protostômios. Em humanos, esta família é formada por três proteínas: FMRP, FXR1P e FXR2P (Cheever and Ceman, 2009). No entanto, em D. melanogaster tem sido mostrada a presença de apenas uma proteína ortóloga, dFXR (ou dFMR1 ou dFMRP)(Morales et al., 2002). Tanto as parálogas de FMRP de humanos como a proteína de D. melanogaster estão envolvidas no silenciamento gênico mediado por miRNAs interagindo física e funcionalmente com a maquinaria de miRNAs (Morales et al., 2002; Jin et al., 2004; Cheever and Ceman, 2009). Em S. mansoni duas das quatro proteínas preditas foram mapeadas em cromossomos sexuais corroborando com dados de espécies de Deuterostômios que mostra pelo menos uma ortóloga FMRP em cromossomos sexuais. Por exemplo, em humanos o gene que codifica a proteína FMRP tem sido encontrado no cromossomo sexual X (Hoogeveen et al., 2002). No entanto, as parálogas FXR1P e FXR2P são encontradas em cromossomos autossômicos agindo de forma semelhante, mas não compensando totalmente a deficiência da proteína FMRP (Hoogeveen et al., 2002). As proteínas preditas, SmFMR1.1, SmFMR1.2, SmFMR1.3 e SmFMR1.4, apresentaram alta similaridade com proteínas FMRP de organismos ortólogos, com domínios conservados característicos da família (Figura 15). Esta família em humanos tem mostrado a presença principal de dois domínios de interação com ribonucleoproteínas: domínio KH (hnRNP-K) e RGG Box (domínio rico em arginina-glicina-glicina)(Bassell and Warren, 2008). Alguns exemplos de proteínas ortólogas de FMRP têm mostrado como domínio característico e desempenhador de sua função, o domínio KH1. Por exemplo, a proteína dFMR1 de D. melanogaster apresenta dois domínios KH1 originados por duplicação e tem sido relatada seus envolvimento com o controle da atividade neuronal. Também foi observado que a expressão inibida do gene DFmr1 em diferentes células, desencadeia fenótipos distintos, sugerindo a participação desta proteína em diversos alvos e mecanismos intracelulares (Morales et al., 2002). Análises comparativas entre dFMR1 e as quatro proteínas preditas neste trabalho revelaram a presença dos 2 domínios KH1 geminados. A presença destes domínios foi 48

(78) Via de silenciamento gênico mediada por miRNAs em S. mansoni observada comparando a estrutura primária das proteínas preditas com o banco de dados de domínios conservados PFAM (Figura 15). Os valores de similaridade de cada domínio KH1 nas sequências foram mostrados na Figura 15. A presença destes domínios característicos é um indicativo da conservação da função destas proteínas em S. mansoni mesmo atuando em um sistema nervoso primitivo. O sistema nervoso do parasito é formado por dois gânglios nervosos, que estão ligados a dois cordões nervosos ventrais e longitudinais, que são ligados por comissuras transversais que percorrem toda a região ventral até a parte posterior do verme (Collins et al., 2011). Estudo de imunofluorescência tem mostrado a presença de diversas estruturas neuronais distribuídas por toda estrutura corporal do parasito envolvidas em funções essenciais do organismo como controle da secreção das glândulas acetabulares durante a penetração no hospedeiro definitivo (Cousin and Dorsey, 1991; Collins et al., 2011). A confirmação da presença destes genes no genoma do parasito abre perspectivas para o estudo e o controle efetivo da infecção de S. mansoni, já que estes genes desempenham funções essenciais para sua sobrevivência do organismo. Figura 15: Conservação evolutiva dos domínios de FMR1. As proteínas ortólogas FMR1 encontradas nos organismos D. melanogaster e aquelas identificadas no parasito S. mansoni foram comparadas quanto a disposição e presença de domínios conservados na estrutura primária. Cada domínio está representado por uma caixa cinza entre o início e o término dos resíduos de aminoácidos da proteína. O tamanho de cada proteína está indicado no final de cada sequência e os valores comparativos de cada domínio estão indicados a direita de cada sequência. 49

(79) Via de silenciamento gênico mediada por miRNAs em S. mansoni No intuito de observar a distribuição filogenética das proteínas identificadas SmFMR1.1, SmFMR1.2, SmFMR1.3 e SmFMR1.4 com suas ortólogas de Protostômios e Deuterostômios foi realizada uma análise filogenética utilizando como matriz Neigbornjoining e como modelo JTT. A distribuição filogenética das proteínas se mostrou bem semelhante à distribuição das proteínas ortólogas de S. japonicum devido sua proximidade evolutiva (Figura 16). Duas das proteínas identificadas, SmFMR1.1 e SmFMR1.2, permaneceram em um clado entre organismos Deuterostômios e organismos Protostômios Ecdysozoans. Elas se agruparam juntamente com proteínas preditas provenientes de organismos Lophotrochozoans como A. california (Molusco) e S. japonicum (Platelminto). As proteínas SmFMR1.3 e SmFMR1.4 agruparam em outro clado, juntamente com as proteínas ortólogas de S. japonicum, CAX83129.1 e CAX83129.1 (Figura 16). A distribuição das proteínas ortólogas de FMRP, na Figura 16, corroborou com a distribuição da árvore da vida onde as espécies animais se separam em dois grandes superfilos Deuterostômios (blastóporo se transformando em anus) e os Protostômios (blastóporo transformando em boca). Figura 16: Distribuição evolutiva das proteínas FMR1. A árvore filogenética consenso foi baseada na sequências de resíduos de aminoácidos de proteínas ortólogas FMR1. Para árvore consenso e confiabilidade dos ramos formados foram utilizados testes de bootstrap com 2000 réplicas e mínimo de 50% para cada ramo confiável. A árvore mostrou clados distintos (representados por colchetes) sendo um para cada grupo de proteínas ortólogas. As proteínas 50

(80) Via de silenciamento gênico mediada por miRNAs em S. mansoni evidenciadas em caixas representam as proteínas identificadas neste trabalho. A construção da árvore e a análise do “bootstrap” foram realizadas no programa MEGA 4.0. III.3.1.4 Tudor-SN (Tudor staphylococcal nuclease) A busca por proteínas preditas ortólogas Tudor-SN no genoma de S. mansoni revelaram a presença de dois transcritos e duas proteínas, provavelmente truncadas no genoma. As regiões no genoma preditas para este gene provavelmente estão com um erro de anotação levando ao truncamento das sequências protéicas Smp_166110 e Smp_081570. Consequentemente o tamanho das sequências de aminoácidos codificadas por estes genes estão com tamanhos e estruturas subestimadas. Uma alternativa para encontrar a sequência correta foi buscar, no banco de dados de sequências (ESTs) do parasito, sequências que cobriam uma maior parte do gene Tudor-SN. Este gene e seu produto protéico foram obtidos através de uma etiqueta de sequência expressa (EST) obtida nos dados de transcriptoma do parasito (EST-Sm01663) (Tabela 4). A sequência EST encontrada, Sm01663, mostrou codificar um produto protéico maior com estrutura semelhante aos genes ortólogos. Além disso, a proteína predita contém tamanho semelhante às proteínas Tudor-SN ortólogas sugerindo uma melhor predição para provável proteína. A proteína Tudor-SN, também chamada de p100, SND1 ou TDRD11, tem sido identificada em diversos organismos, desde seres unicelulares como leveduras até multicelulares como humanos(Callebaut and Mornon, 1997; Howard-Till and Yao, 2007; Li et al., 2008; Zheng et al., 2009). A proteína Tudor-SN tem apresentado como característica estrutural predominante, a presença de dois domínios conservados: domínio Tudor e domínio SN. Tem sido mostrado, em relação à disposição destes domínios na proteína, a presença seqüencial de domínios SN (in tandem) na parte N-terminal da proteína e um domínio Tudor na porção C-terminal (Callebaut et al., 1997; Li et al., 2008). O domínio SN (staphylococcal nuclease-like) tem como característica principal a função nucleásica hidrolisando fitas duplas de RNA (Callebaut et al., 1997; Li et al., 2008). Em geral, as proteínas Tudor-SN são estruturadas com quatro repetições do domínio SN in tandem, um domínio Tudor na parte Cterminal seguido por um domínio SN incompleto no fim da proteína. A mesma disposição de domínios tem sido observada na proteína predita SmTudor-SN (Figura 17). O domínio SN é homólogo de um domínio SN contido em uma proteína chamada thermonuclease-SN de Staphylococcus aureus. Esta proteína apresentou tamanho de 149 resíduos de aminoácidos contendo o domínio SN como parte quase integral de sua estrutura. 51

(81) Via de silenciamento gênico mediada por miRNAs em S. mansoni Utilizando modelagem 2D de resíduos hidrofóbicos, predição da estrutura secundária e modelagem 3D das proteínas foi possível o estudo da proteína predita SmTudor-SN. Esta estratégia tem sido utilizada para proteínas com estruturas primárias dissimilares mas estruturas secundárias semelhantes (Callebaut et al., 1997). Esta mesma estratégia foi utilizada para a caracterização da proteína SmTudor-SN em S. mansoni já que esta apresenta estrutura primária relativamente dissimilar. A proteína termonuclease-SN de S. aureus foi comparada com a proteína predita SmTudor-SN a fim de observar, ao nível secundário de estrutura, suas semelhanças. A Figura 17 apresenta uma modelagem 2D de resíduos hidrofóbicos e uma predição das estruturas secundárias das proteínas termonuclease e SmTudor-SN (Figura 17). A presença de um padrão de estrutura secundária característica dos domínios SN tem sido mostrada em trabalhos anteriores (Callebaut et al., 1997; Zheng et al., 2009). A proteína termonuclease mostrou um padrão característico de estruturas secundárias de nucleases β1-β2-β3-α1-β4-β5-α2-α3 (Figura 17). O mesmo perfil de estrutura secundária foi mostrado nos domínios SN (1), SN (2), SN (3) e SN (4) da proteína predita SmTudor-SN corroborando com os resultados de termonuclease-SN (Figura 17). Estes domínios apresentaram resíduos Asp / Asp importantes no processo de catálise e ligação em fitas de ácidos nucléicos. O domínio SN (5) predito apresentou-se incompleto em SmTudor-SN, assim como ocorre em proteínas Tudor-SN ortólogas como em D. melanogaster, não apresentando os resíduos funcionais para catálise não participando diretamente no sítio ativo da enzima. O padrão de estrutura secundária β1-β2-β3-α1-β4-β5-α2-α3, tem importantíssimo papel na interação do domínio SN com os oligonucleotídeos assim como na execução da função da proteína. Estes resultados corroboram com resultados anteriores que demonstraram a conservação da estrutura secundária e dos resíduos hidrofóbicos de proteínas Tudor-SN em humanos, D. melanogaster e Takifugu Rubripes (Callebaut et al., 1997; Zheng et al., 2009) Como pode ser observado na Figura 18 os domínios SN da proteína SmTudor-SN apresentaram grandes similaridades ao nível estrutural com o domínio SN da proteína 2SNS. Apesar da baixa identidade ao nível de aminoácidos entre estas duas proteínas, é notável a semelhança estrutural. Isto pode ser explicado pela manutenção da propriedade dos aminoácidos nas estruturas primárias. Pode se notar na estrutura tridimensional a presença de estruturas secundárias, α hélices e folhas betas, como preditas anteriormente na Figura 17. A estrutura terciária de cada domínio confirmou a presença da sequência característica das estruturas, β1-β2-β3-α1-β4-β5-α2-α3, responsável pela função de ligação a fita dupla de RNA e atividade catalítica (Figura 18). . 52

(82) Via de silenciamento gênico mediada por miRNAs em S. mansoni Figura 17: Estruturas secundárias e resíduos hidrofóbicos das proteínas contendo domínio SN. As proteínas termonuclease (Staphylococcal Nuclease -2SNS) e SmTudor-SN foram representadas na forma 2D evidenciando a estrutura secundária e os resíduos 53

(83) Via de silenciamento gênico mediada por miRNAs em S. mansoni hidrofóbicos de cada porção da proteína. As estruturas secundárias foram preditas pelo programa PredictProtein e representadas por retângulos verticais azuis as α hélices e pelos retângulos verticais vermelhos as folhas beta. Os domínios SN foram indicados em cada estrutura por um traço contínuo preto mostrando em suas extremidades o resíduo de aminoácido inicial e final. Os residuos de aminoácidos foram representados pelas letras referentes exceto prolina, glicina, serina e treonina que foram representados por ★,◆,▣ e □, respectivamente. Os sítios catalíticos presentes na proteína 2SNS, descritos por, Ponting (1997) foram mostrados por setas (D21, F34, D40, E43, K84, Y85 and R87). A sequência β1β2-β3-α1-β4-β5-α2-α3 foram mostradas no gráfico representando a sequência de estruturas secundárias caracteristica de domínios SN. As estruturas secundárias foram preditas utilizando o programa PredictProtein. 54

(84) Via de silenciamento gênico mediada por miRNAs em S. mansoni Figura 18: Estruturas tridimensionais dos domínios conservados SN em SmTudor-SN e Staphylococcal Nuclease (2SNS). A ilustraçao em forma de desenho foi obtida atavés da modelagem baseada em homologia no banco de dados repositório Swiss-Model. O programa Pymol foi utilizado para exposição dos domínios SN obtidos das proteínas SmTudor-SN e Staphylococcal Nuclease. As estruturas α hélices foram representadas pelas cores vermelho, amarelo e azul claro e as folhas beta representadas por setas azuis e verdes. 55

(85) Via de silenciamento gênico mediada por miRNAs em S. mansoni As proteínas Tudor-SN símile são encontradas em diversos organismos pertencentes a reinos distantes como Plantae, Metazoa e Fungi revelando uma distribuição taxonômica ampla desta proteína (Howard-Till and Yao, 2007; Yang et al., 2007; Li et al., 2008; Zheng et al., 2009). Neste trabalho, foi realizada uma análise filogenética empregando como matriz Neigborn-joining e modelo JTT para construção da história evolutiva da proteína predita SmTudor-SN e suas ortólogas. A distribuição filogenética de SmTudor-SN corroborou com a distribuição da árvore da vida com separação de Filos e Superfilos. A proteína SmTudor-SN agrupou juntamente com as proteínas pertencentes a espécies do Superfilo Protostômios, próximo de artrópodes e nematóides (Figura 19). A conservação da proteína SmTudor-SN de S. mansoni ao nível estrutural, corrobora com a hipótese de que a via de silenciamento gênico mediada por miRNA é conservada no parasito e que também pode participar de outros processos celulares importantes, como por exemplo, no processamento do RNA. Figura 19: Distribuição evolutiva das proteínas Tudor-SN. A árvore filogenética consenso foi baseada na sequências de resíduos de aminoácidos de proteínas ortólogas Tudor-SN encontradas em três diferentes reinos: Fungi, Plantae e Metazoa. Para árvore consenso e confiabilidade dos ramos formados foram utilizados testes de bootstrap com 2000 réplicas e mínimo de 50% para cada ramo confiável. A árvore mostrou clados distintos (representados por colchetes) sendo um para cada reino. As proteínas evidenciadas em caixas representam as proteínas identificadas neste trabalho. A construção da árvore e a análise do “bootstrap” foram realizadas no programa MEGA 4.0. 56

(86) Via de silenciamento gênico mediada por miRNAs em S. mansoni III.3.2 Análise da expressão gênica Para avaliar a expressão relativa dos genes envolvidos no silenciamento gênico mediado por miRNA (SmDrosha1/2, SmPartner-Drosha, SmPartner-Dicer, SmFmr1.1, SmTudor-SN e SmExportin-5.1/2) foi utilizada a técnica de qRT-PCR e as seguintes fases do parasito: cercária, esquistossômulos mecanicamente transformados de 3,5 horas (EMT-3,5), 1 dia (EMT-24), 2 dias (EMT-48), 3 dias (EMT-72), 5 dias (EMT-5d), 7 dias (EMT-7d) e vermes adultos. Os transcritos foram avaliados neste estudo e os dados foram normalizados utilizando o gene endógeno α tubulina em todos os estágios estudados. As figuras 20, 21 e 22 mostram o padrão de expressão gênica dos constituintes da via de miRNAs em diferentes estágios do parasito. Todos os genes analisados foram expressos nos estágios analisados, entretanto, observou-se que a quantidade relativa de mRNA destes genes nos estágios de cercária e esquistossômulos recém transformados (EMT-3,5 e EMT-24) mostraram expressão 2 vezes maior em relação aos outros estágios (p<0.05) (Figura 20, 21 e 22). Analisando individualmente a quantidade relativa de mRNA dos genes que codificam proteínas do complexo RISC, foi possível verificar que SmFmr1.1 é o mais abundante. O gene SmFmr1.1 foi encontrado regulado com expressão mais elevada nos estágio de cercária, EMT-3.5h, EMT-24h e EMT-5d. No caso específico do estágio de vida cercária, o transcrito deste gene apresentou de 2 a 15 vezes mais expressão do que os outros genes. Isto sugere que este gene pode estar envolvidos com outras funções além do silenciamento gênico mediado por miRNAs. Em D. melanogaster tem sido encontrado apenas uma representante homóloga da proteína FMRP encontrada em mamíferos chamada DFmr1. Tem sido relatado, em D. melanogaster, que o envolvimento desta proteína não está apenas relacionado com atividades de silenciamento mediada por miRNAs mas também controle neuronal. Diferentes células neuronais com a expressão inibida do gene DFmr1 apresentaram diferentes fenótipos sugerindo a participação desta proteína em diversos alvos e mecanismos (Morales et al., 2002). Estudos anteriores, em células animais, têm relatado a participação deste gene, em altas concentrações, no controle da tradução de alguns genes alvos (Mazroui et al., 2002). Assim como SmFmr1.1, os transcritos de SmDrosha1/2 e SmExportin5.1/2 mostraram expressões elevadas em cercária e EMT-3,5. O transcrito SmTudor-SN apresentou uma alta expressão em cercária evidenciando a tendência de uma maior expressão dos transcritos da via de miRNAs neste estágio. SmPartner-Drosha e SmPartner-Dicer demonstraram a mesma tendência de alta expressão em cercárias e esquistossômulos jovens com um decréscimo significativo em EMT-5d (Figura 20, 21 e 22). 57

(87) Via de silenciamento gênico mediada por miRNAs em S. mansoni Estudos anteriores tem demonstrado a expressão gênica de alguns componentes da maquinaria de silenciamento gênico mediada por miRNAs no gênero Schistosoma (KrautzPeterson and Skelly, 2008; Gomes et al., 2009; Chen et al., 2010; Luo et al., 2010). KrautzPeterson (2008) demonstrou a expressão do gene SmDicer em diversas fases do parasito S. mansoni. Ele demonstrou uma expressão elevada nas fases de ovos e esquistossômulos quando comparada com vermes adultos. A mesma conclusão foi observada por nosso grupo em 2009, em relação ao transcrito do gene SmDicer na qual foi observada uma expressão mais elevada na fase de ovos e esquistossômulos quando comparada com outras fases (Gomes et al., 2009). Isto pode estar associado à diferenciação gênica que o parasito sofre nas primeiras horas pós-infecção levando a um controle da expressão gênica mais acentuada nas fases de esquistossômulos. Além disso, a expressão gênica dos transcritos de SmAgo2/3/4 nas diferentes fases do parasito apresentou semelhante perfil de expressão (Gomes et al., 2009). No parasito S. japonicum tem sido também descrito um perfil diferencial nas expressões de genes centrais da via de miRNAs como Argonauta e Dicer (Chen et al., 2010; Luo et al., 2010). Chen, 2010 mostrou que a expressão dos genes Argonautas, tanto ao nível de mRNA (Real Time PCR) quanto ao nível protéico (Western Blotting), foi mais abundante em ovos quando comparada com outros estágios corroborando com dados de S. mansoni. Além disso, houve uma expressão diferencial em vermes adultos fêmea e macho (Chen et al., 2010). A hipótese levantada é que existe uma correlação positiva entre a abundância de mRNA envolvidos na biogênese de miRNAs e a quantidade de miRNAs nos estágios de transição cercária-esquistossômulos. Figura 20: Expressão relativa dos genes (A) SmDrosha1/2 e (B) SmExportina5.1/2 no desenvolvimento de S. mansoni. A expressão destes genes foi avaliada nos estágios de cercárias, esquistossômulos mecanicamente transformados (EMT-3,5 horas, EMT-24 horas, 58

(88) Via de silenciamento gênico mediada por miRNAs em S. mansoni EMT-48 horas, EMT-72 horas, EMT-5 dias, EMT-7 dias) e vermes adultos. Como normalizador (gene constitutivo) foi utilizado o gene da α-tubulina e a expressão gênica relativa foi determinada pelo método do 2-ΔCt. A análise estatística foi realizada utilizando o teste de Tukey com P<0,05 no programa GraphPad Prism. As diferenças estatísticas entre os estágios foram determinadas pelos sinais: * diferente de cercária, ** diferente de EMT-3,5 horas, *** diferente de EMT-24 horas, # diferente de EMT-48 horas, ## diferente de EMT-72 horas, ### diferente de EMT-5 dias, & diferente de EMT-7 dias. Figura 21: Expressão relativa dos genes (A) SmPartner-Dicer e (B) SmPartner-Drosha no desenvolvimento de S. mansoni. A expressão destes genes foi avaliada nos estágios de cercárias, esquistossômulos mecanicamente transformados (EMT-3,5 horas, EMT-24, EMT48 horas, EMT-72 horas, EMT-5 dias, EMT-7 dias) e vermes adultos. Como normalizador (gene constitutivo) foi utilizado o gene da α-tubulina e a expressão gênica relativa foi determinada pelo método do 2-ΔCt. A análise estatística foi realizada utilizando o teste de Tukey com P<0,05 no programa GraphPad Prism. As diferenças estatísticas entre os estágios foram determinadas pelos sinais: * diferente de cercária, ** diferente de EMT-3,5 horas, *** diferente de EMT-24 horas, # diferente de EMT-48 horas, ## diferente de EMT-72 horas, ### diferente de EMT-5 dias, & diferente de EMT-7 dias. Figura 22: Expressão relativa dos genes (A) SmTudor-SN e (B) SmFmr1.1 no desenvolvimento de S. mansoni. A expressão destes genes foi avaliada nos estágios de cercárias, esquistossômulos mecanicamente transformados (EMT-3,5 horas, EMT-24 horas, EMT-48 horas, EMT-72 horas, EMT-5 dias, EMT-7 dias) e vermes adultos. Como 59

(89) Via de silenciamento gênico mediada por miRNAs em S. mansoni normalizador (gene constitutivo) foi utilizado o gene da α-tubulina e a expressão gênica relativa foi determinada pelo método do 2-ΔCt. A análise estatística foi realizada utilizando o teste de Tukey com P<0,05 no programa GraphPad Prism. As diferenças estatísticas entre os estágios foram determinadas pelos sinais: * diferente de cercária, ** diferente de EMT-3,5 horas, *** diferente de EMT-24 horas, # diferente de EMT-48 horas, ## diferente de EMT-72 horas, ### diferente de EMT-5 dias, & diferente de EMT-7 dias. Os resultados obtidos até o momento sugerem que os genes envolvidos no silenciamento gênico mediado por miRNA são mais abundantes em cercárias e esquistossômulos jovens (Figuras 20, 21 e 22). Considerando que a cercária é a forma infectante do hospedeiro mamífero e que a sobrevivência do parasito envolve adaptações devido a troca de ambiente, diferentes temperaturas, concentração de glicose e passando de um ambiente com alto nível de oxigênio (meio aquático) para um rico em gás carbônico (plasma sanguíneo), sugere-se que a via de processamento de miRNAs provavelmente desempenha um papel importantíssimo nesta transição e adaptação. Após a perda da calda, a cercária passa por momentos de instabilidade dentro do hospedeiro definitivo onde sofre uma série de eventos a fim de adquirir novas características para sua sobrevivência. Uma característica desta fase de transição é a capacidade do organismo sobreviver sem uma transcrição real de mRNAs e uma tradução real de proteínas, o que levantou a hipótese da participação de processos pós-transcricionais regulando genes nesta fase (Wilson and Barnes, 1979; Blanton and Licate, 1992). Baseado nesta hipótese e nos resultados encontrados neste trabalho, pode ser sugerido uma possível participação efetiva de miRNAs no silenciamento gênico durante transição cercária para esquistossômulos jovens. Uma perspectiva deste trabalho é a realização de Western Blot para as proteínas da via de miRNAs preditas no parasito a fim de obter informações mais exatas da participação desta via no silenciamento gênico mediado por miRNAs nos diferentes estágios do parasito. III.3.3 Regulação pós-transcicional em S. mansoni Baseado nas funções destas proteínas e suas prováveis posições nos compartimentos celulares, núcleo e citoplasma, sugere-se um mecanismo de participação desta via no parasito S. mansoni. A via de miRNA, em S. mansoni, possui três proteínas preditas presentes no núcleo: SmDrosha1, SmDrosha2 e SmPartner-Drosha. Elas tem como funções o reconhecimento dos miRNAs primários, transcritos a partir do genoma, e o processamento em precursores de miRNAs para posterior transporte núcleo-citoplasma. Esta função de transporte núcleo-citoplasma é desempenhada por proteínas presentes na membrana nuclear 60

(90) Via de silenciamento gênico mediada por miRNAs em S. mansoni como XPO-1 e XPO-5. As proteínas identificadas em S. mansoni com a função de transporte núcleo-citoplasma foram SmExportina5.1 e SmExportina5.2 e para o caminho inverso citoplasma-núcleo SmExportina1.1 e SmExportina1.2. No citoplasma os precursores de miRNAs são reconhecidos por um complexo semelhante ao complexo nuclear SmDrosha/SmPartner-Drosha, denominado SmDicer/SmPartner-Dicer. Ambos os processos são formados por uma RNAseIII e uma proteína ligante de RNA auxiliar com funções similares de clivagem de fita dupla de RNA. Após a segunda clivagem, o miRNAs maduro é liberado e então reconhecido pelo complexo de silenciamento gênico mediado por miRNAs denominado RISC. Em S. mansoni foram preditas as seguintes proteínas constituintes deste processo: SmAgo1, SmAgo2, SmAgo3, SmAgo4, SmFmr1.1, SmFmr1.2, SmFmr1.3, SmFmr1.4 e SmTudor-SN. As proteínas necessárias para formação de RISC e os miRNAs maduros compõe este complexo ribonucleomultiproteico. A Figura 23 ilustra como seria a atuação conjunta destes 13 genes e 18 transcritos na biogênese de miRNAs, evidenciando que o parasito tem todos os genes essenciais para fazer uma regulação da expressão gênica ao nível pós-transcricional. A grande questão é: qual a vantagem para o parasita transcrever normalmente um gene, mas não traduzido-lo? Seria importante para o estabelecimento do parasitismo? Para a diferenciação e/ou desenvolvimento do parasito? O fato dos genes envolvidos na formação do complexo RISC serem diferencialmente expressos levanta a hipótese de que essa via tem um papel importante no silenciamento gênico em cercárias, entretanto o repertório de miRNA em S. mansoni é pouco conhecido. Estas evidências nos motivaram a explorar os dados genômicos e transcriptômicos para identificar miRNAs em S. mansoni. Finalmente, parte dos resultados apresentados neste capitulo serviram para a elaboração do manuscrito intitulado Evolutionarily conserved and developmentally-regulated expression of miRNA biogenesis and RISC complex components in Schistosoma mansoni., em revisão no periódico Gene (Anexo 2). 61

(91) Via de silenciamento gênico mediada por miRNAs em S. mansoni Figura 23: Mecanismo proposto da via de silenciamento gênico mediada por miRNAs no parasito S. mansoni. A via de miRNA envolve grupos de proteínas nucleares e citosólicas. As proteínas nucleares tem a função de expressar e processar o miRNA primário e posteriormente exportá-lo para o citoplasma. No citoplasma, proteínas processam os precursores de miRNA transformando-os em moléculas ativas aptas a atuarem no processo de regulação da expressão gênica. 62

(92) Predição Computacional de miRNAs em S. mansoni Capítulo IV Predição computacional de miRNAs em S. mansoni 63

(93) Predição Computacional de miRNAs em S. mansoni IV.1 Justificativa Diferentes estratégias têm sido empregadas para identificação de miRNAs, maduros e seus precursores, em diversas espécies de fungos, plantas e animais (Hammond, 2006; Huang et al., 2010). A identificação de miRNAs, conservados e não conservados, tem sido realizada utilizando estratégias experimentais e computacionais (Hammond, 2006; Huang et al., 2010). A detecção destas moléculas utilizando estratégia experimental (baseada em clonagem molecular, sequenciamento e expressão) pode ser tecnicamente um desafio, particularmente devido à transcrição dos miRNAs serem restritas a determinadas condições ou tipos celulares (Li et al., 2010a). Cobrindo esta deficiência, as abordagens computacionais vêm auxiliando as abordagens experimentais na identificação de novos miRNAs. Uma das vantagens das estratégias in silico tem sido a utilização de sequências do genoma e/ou transcriptoma para identificação de novos miRNAs evitando a perda de miRNAs reais expressos apenas em tecidos ou estágios específicos ou em quantidades muito inferiores ao mínimo detectável pela metodologia. No entanto, a identificação dos miRNAs possuem limitações como incapacidade de utilização de ferramentas convencionais de alinhamento de sequências e complexidade na obtenção dos algoritmos empregados. Nos últimos anos, vários miRNAs, identificados computacionalmente, têm sido validados empregando métodos experimentais. A elaboração de ferramentas mais específicas para predição de miRNAs, direcionando a identificação de por exemplo, miRNAs espécie-específicos, tem favorecido a sensibilidade dos métodos, aumentando as chances de se obter moléculas biologicamente reais. O estudo e caracterização de miRNAs no gênero Schistosoma tem sido empregados com sucesso (Xue et al., 2008; Copeland et al., 2009; Huang et al., 2009; Hao et al., 2010; Wang et al., 2010). Copeland (2009) baseado em homologia de sequências identificou e caracterizou diferentes classes de ncRNAs, incluindo, miRNAs. O número de miRNAs conservados encontrados em S. mansoni foi notavelmente baixo sugerindo um estilo de parasitismo específico. Simões (2011) utilizando abordagem computacional, bibliotecas de RNA e Northern blot identificou prováveis miRNAs em S. mansoni sendo a maioria espécieespecífico. No entanto, um estudo mais detalhado do repertório de miRNAs conservados e não conservados em S. mansoni tem sido considerado necessário. Neste trabalho, foi utilizada uma abordagem computacional robusta para identificação, caracterização e mapeamento de miRNAs no genoma e transcriptoma de S. mansoni, avaliando tanto os miRNAs conservados quanto os não conservados. Esta estratégia 64

(94) Predição Computacional de miRNAs em S. mansoni vem suprir as necessidades de obtenção e caracterização de novos miRNAs conservados e não conservados envolvidos na regulação da expressão gênica no parasito. 65

(95) Predição Computacional de miRNAs em S. mansoni IV.2 Materiais e Métodos IV.2.1 Banco de dados de sequências de miRNAs e de S. mansoni As sequências do genoma e transcriptoma de S. mansoni foram recuperadas a partir do banco de dados GeneDB (http://www.genedb.org) (Berriman et al., 2009). A partir da nova versão do genoma, v5.0, foram recuperados em formato fasta 885 sequências scaffolds (Berriman et al., 2009). Cada sequência, representando um scaffold, foi separada em formato fasta distinto facilitando a recuperação de trechos específicos. Estas sequências foram armazenadas em formato fasta para utilização em análises posteriores. Os miRNAs, 17341 formas maduras e 15172 precursores, foram recuperados a partir do banco de dados de miRNAs (Welcome Trust Sanger Institute’s miRBase, http://microrna.sanger.ac.uk - release 16.0)(Griffiths-Jones, 2010; Kozomara and GriffithsJones, 2011). A separação das sequências de miRNAs, precursoras e maduras, representando clados específicos dentro da árvore filogenética da vida, foi realizada utilizando miRBase Browser e um script escrito em PERL. Este script selecionou dentre os miRNAs depositados no banco de dados, aqueles que pertenciam a cada grupo específico, ou espécie determinada. Assim, foi separado em vários arquivos multi-fasta, sequências de miRNAs maduros e precursores referentes às espécies do clado: Animais, Deuterostômios, Protostômios, Ecdysozoa, Lophotrochozoa e Schistosoma. IV.2.2 Identificação de miRNAs maduros e seus precursores (pré-miRNAs) Para identificação e busca de prováveis miRNAs maduros e seus precursores no parasito S. mansoni foi desenvolvido um algoritmo integrado e otimizado almejando miRNAs conservados e não conservados, partindo de sequências depositadas em bancos de dados de genoma e transcriptoma de S. mansoni. Primeiramente, foram obtidas as sequências do genoma e transcriptoma com potencial formação de estruturas de grampo ou com alta similaridade com estruturas secundárias de pré-miRNAs de animais. Para esta etapa, os programas blastn e Einverted (ferramenta EMBOSS) foram empregados. Os parâmetros utilizados para o programa Einverted foram maxrepeat 95 nucleotídeos e “score threshold” coletando sequências entre 60 e 100 nucleotídeos, faixa de tamanho correspondente a maioria dos pré-miRNAs conhecidos até o momento. Para execução do Blastn foram utilizadas 11796 sequências de busca representando os pré-miRNAs de todas as espécies de animais 66

(96) Predição Computacional de miRNAs em S. mansoni depositadas no banco de dados de miRNAs miRBase. Os parâmetros utilizados foram e-value menor que 0,001 tamanho mínimo de pareamento 25 nucleotídeos por sequência e 80% de identidade na região reconhecida como similar. As sequências produtos foram recuperadas dos bancos de dados de S. mansoni considerando o número de nucleotídeos a jusante e a montante da sequência de busca inicial. Para execução deste procedimento o programa blastn foi instalado em plataforma Linux e executado juntamente com um script desenvolvido em PERL para recuperação das sequências. Desta forma, foi possível obter a partir dos dois bancos, aproximadamente um milhão e trezentas mil (1300000) sequências com formato provável de grampo (“hairpin”). A Figura 24 ilustra todo o procedimento executado para identificação de precursores e formas maduras de miRNAs conservados e não conservados. IV.2.3 Identificação de miRNAs conservados Para aumentar a eficácia e acurácia da predição dos pré-miRNAs (pré-miRNAs) e suas formas maduras, as 1300000 sequências, foram empregadas em uma série de filtros. O intuito destes filtros foi eliminar sequências indesejáveis e permitir a permanência daquelas correspondentes aos prováveis miRNAs. Estes filtros foram selecionados baseados em características conservadas de precursores reais de miRNAs e características de regiões conhecidas que não tinham potencial para formação de pré-miRNAs. Cada etapa eliminou sequências que não enquadravam nas características de pré-miRNAs e manteve aquelas sequências com características compatíveis. O primeiro filtro analisado utilizou a propriedade de dobramento da estrutura secundária dos pré-miRNAs para eliminar sequências que não correspondiam a prováveis moléculas de pré-miRNAs. Essa propriedade foi analisada utilizando valores da energia livre mínima (MFE) das moléculas após o dobramento obtido a partir do programa RNAfold utilizando os parâmetros "-p -d2 -noLP" (Hofacker, 2009) . O valor de energia livre mínima, -20 kcal/mol, em geral, é considerada a energia necessária para que uma molécula de pré-miRNAs sejam estáveis e possam gerar miRNAs maduros em etapas subseqüentes. Desta forma, aquelas sequências com valores menores que -20 kcal/mol, mais estáveis, foram separadas e analisadas em relação ao seu conteúdo de guanina e citosina (GC). 67

(97) Predição Computacional de miRNAs em S. mansoni Figura 24: Fluxograma da abordagem computacional para identificação de miRNAs conservados e não conservados em S. mansoni O algoritmo criado aceitou como sequências positivas aquelas com conteúdo de GC entre 30% e 65%, valores apropriados para pré-miRNAs em animais (Zhou et al., 2009). No próximo filtro foi utilizado 13278 miRNAs maduros provenientes de organismos do reino Animal, depositados no miRBase, e comparados utilizando Blastn com as sequências precursoras remanescentes do passo anterior. Foi admitido como similaridade mínima 68

(98) Predição Computacional de miRNAs em S. mansoni àquelas sequências que mostraram um mínimo de 85% de identidade em relação ao conteúdo de nucleotídeos total do miRNA maduro e 100% com a região semente (“seed region”) do mesmo. Além disso, as sequências foram descartadas as sequências no qual os miRNAs maduros correspondentes foram encontrados nos loops das estruturas secundárias evitando falsos positivos. As sequências remanescentes neste passo foram verificadas quanto sua identidade em relação aos prováveis RNAs não codificadores de proteínas preditos por Copeland (2009) no parasito S. mansoni. Estão incluídos nesta biblioteca de sequências de RNAs não codificadores moléculas tais como: RNA ribossomais (5S, 18S, 5.8S e 28S), provável 7SK, provável MRP, RNase P, siRNAs, componentes dos spliceossoma snRNAs (U1, U2, U4, U4atac, U5, U6, U6atac, U11, U12), SRP, RNA transportadores e snoRNA. Foi usado o blastn para verificação de similaridade entre as sequências. O parâmetro utilizado para eliminação de sequências foi e-value menor que 0,0001, alinhamento mínimo entre o par de sequências de 40 nucleotídeos e 95% de identidade entre as sequências. No passo seguinte, foram eliminadas as sequências com alta similaridade com predita região codificadora de proteína. Foi utilizada para esta identificação o programa blastn com valores similares aos mostrados acima e sequências query de busca mRNAs provenientes de predições gênicas contidas no banco de dados GeneDB. A próxima etapa eliminou as sequências com alta identidade com regiões de elementos repetitivos, assim como transposons, retrotransposons, repetições simples, repetições in tandem e outras. Foi utilizado RepeatMasker, alocado no site (http://www.repeatmasker.org/), para eliminação das sequências com alta similaridade com sequências repetitivas presentes no genoma de S. mansoni (Chen, 2004). Utilizamos como ferramenta de busca, a ferramenta “search engine”, e como auxiliar, “cross_match”, que apesar de ser mais lenta para o processamento das sequências, frequentemente responde mais sensivelmente as buscas no banco de dados. As três etapas anteriores foram estritamente importantes devido ao fato que tanto as moléculas de RNAs não codificadoras de proteínas quanto às moléculas de elementos repetitivos e mRNAs possuírem estruturas secundarias estáveis e muitas vezes semelhantes estruturalmente aos pré-miRNAs. Finalmente, após a eliminação destas sequências, a ferramenta Mipred foi empregada com o intuito de classificar as estruturas de miRNAs. Esta ferramenta utiliza tecnologia de aprendizado de maquina vetorizado e “random Forest” baseado em características específicas das moléculas de miRNAs reais, miRNAs não reais e pseudo miRNAs (Jiang et al., 2007). Esta ferramenta tem como função distinguir entre estas três classes, onde se enquadra as sequências não treinadas. As sequências remanescentes do ultimo passo foram então 69

(99) Predição Computacional de miRNAs em S. mansoni alimentadas no programa MiPred para classificação. Foram mantidas como sequências positivas ou seja, preditos pré-miRNAs, apenas aquelas estruturas que classificadas como miRNAs reais. IV.2.4 Identificação de miRNAs não conservados Para identificação de moléculas precursoras e maduras de miRNAs não conservados a estratégia utilizada foi bem semelhante à estratégia de identificação de miRNAs conservados supracitada. O algoritmo acima foi modificado em três pontos distintos. O primeiro ponto alterado foi a manutenção apenas das estruturas secundárias encontradas concomitantemente nos bancos de dados, genômico e transcriptômico de S. mansoni. O outro ponto modificado foi executado no início do procedimento, no qual o procedimento de comparação das prováveis sequências de pré-miRNAs obtidas do transcriptoma e genoma de S. mansoni com o banco de dados de miRNAs maduros de animais do miRBase foi retirado. Foi preciso retirar este passo, pois apenas as sequências não conservadas deveriam ser mantidas no grupo de possíveis sequências. O terceiro e último ponto modificado foi a inclusão no final do procedimento de um programa para busca de sequências de miRNAs maduros em estruturas secundarias de pré-miRNAs. O programa empregado foi MatureBayes web tool disponibilizado no site (http://mirna.imbb.forth.gr/MatureBayes.html)(Gkirtzou et al., 2010). IV.2.5 Análise comparativa dos miRNAs identificados em S. mansoni Análises adicionais foram realizadas utilizando as sequências preditas conservadas e não conservadas de pré-miRNAs encontradas no genoma de S. mansoni. As características destas sequências foram comparadas com um conjunto de pré-miRNAs encontrados em outros grupos de organismos. Utilizando informações provindas do miRBase Browser as sequências foram divididas em 6 grupos distintos: Animais, Deuterostômios, Protostômios, Ecdysozoa, Lophotrochozoa e Schistosoma. Estas análises envolveram o estudo de vários parâmetros relacionados com a estrutura secundária e primária dos pré-miRNAs, dentre eles: energia mínima livre (MFE), tamanho do precursor, energia mínima livre ajustada (AMFE), índice de energia mínima livre (MFEI), conteúdo de GC (GC), energia mínima livre do conjunto termodinâmico (MFEE), diversidade do conjunto termodinâmico e freqüência da estrutura de energia mínima livre no conjunto termodinâmico. O parâmetro AMFE foi medido utilizando o MFE encontrado para 100 nucleotídeos em tamanho. O parâmetro 70

(100) Predição Computacional de miRNAs em S. mansoni AMFE foi calculado seguindo a seguinte formula: MFEI = [(AMFE) × 100] / (G% + C%)] (Zhang et al., 2006a). As medidas de diversidade do conjunto termodinâmico, freqüência da estrutura de energia mínima livre no conjunto termodinâmico e MFE foram obtidas usando RNAfold. O conteúdo de GC e tamanho da sequência foram calculados utilizando scripts escritos em PERL e aplicados para todas as estruturas em questão. IV.2.6 Identificação de clusteres de miRNAs A busca de clusteres de miRNAs foi otimizada utilizando informação obtida através da posição de cada miRNA identificado no genoma de S. mansoni. Os miRNAs encontrados em uma distância menor que dez mil nucleotídeos a jusante ou a montante dependendo da direção na fita de DNA foram considerados ligados em um cluster de miRNA. Cada trecho de sequência foi recuperado do genoma de S. mansoni versão 5.1 utilizando informações do primeiro e ultimo nucleotídeo do cluster. A estrutura secundaria de cada cluster foi obtida utilizando a ferramenta RNAfold (Hofacker, 2009). IV.2.7 Conservação e Distribuição Filogenética dos miRNAs de S. mansoni As sequências de pré-miRNAs conservados assim como seus respectivos miRNAs homólogos foram submetidos ao alinhamento múltiplo de sequência utilizando as ferramentas ClustalX 2.0 e RNAalifold (Thompson et al., 2002). Foram usados os seguintes parâmetros de alinhamento para a ferramenta ClustalX 2.0: abertura de espaço (“gap opening”) 22,50; extensão do espaço (“gap extension”) 0,83(Takane et al., 2010). As sequências de miRNAs maduros conservados de S. foram mansoni submetidos ao Weblogo 2.8.2 (http://weblogo.berkeley.edu/logo.cgi) juntamente com seus respectivos homólogos gerando “logos” de nucleotídeos representativos de cada específica posição do miRNA maduro(Crooks et al., 2004). A distribuição filogenética dos pré-miRNAs de S. mansoni e seus homólogos foi realizada utilizando o método Neighbor joining aplicando o modelo Kimura dois parâmetros (“Kimura-two parameters”) para estimar a divergência entre as sequências(Saitou and Nei, 1987). Tanto o método quanto o modelo foram aplicados utilizando a ferramenta MEGA 4(Tamura et al., 2007). A confiabilidade estatística de cada ramo na árvore gerada foi avaliada utilizando “bootstrap” com 2000 réplicas. Os valores de “bootstrap” maiores que 30 foram mantidos entre os nós de cada ramo. Para melhor visualização nós indicamos o 71

(101) Predição Computacional de miRNAs em S. mansoni agrupamento de sequências baseados na filogenia da arvore evolutiva consenso. As abreviações para cada organismo nas árvores filogenéticas são mostradas a seguir: aae (Aedes aegypti), aga (Anopheles gambiae), age (Ateles geoffroyi), ame (Apis mellifera), api (Acyrthosiphon pisum), bfl (Branchiostoma floridae), bma (Brugia malayi), bmo (Bombyx mori), bta (Bos taurus), cbr (Caenorhabditis briggsae), cel (Caenorhabditis elegans), cfa (Canis familiaris), cin (Ciona intestinalis), cqu (Culex quinquefasciatus), crm (Caenorhabditis remanei), csa (Ciona savignyi), cte (Capitella teleta), dan (Drosophila ananassae), der (Drosophila erecta), dgr (Drosophila grimshawi), dme (Drosophila melanogaster), dmo (Drosophila mojavensis), dpe (Drosophila persimilis), dps (Drosophila pseudoobscura), dpu (Daphnia pulex), dre (Danio rerio), dse (Drosophila sechellia), dsi (Drosophila simulans), dvi (Drosophila virilis), dwi (Drosophila willistoni), dya (Drosophila yakuba), eca (Equus caballus), fru (Fugu rubripes), gga (Gallus gallus), ggo (Gorilla gorilla), hsa (Homo sapiens), isc (Ixodes scapularis), lgi (Lottia gigantea), lmi (Locusta migratoria), mdo (Monodelphis domestica), mml (Macaca mulatta), mmu (Mus musculus), mne (Macaca nemestrina), nlo (Nasonia longicornis), nvi (Nasonia vitripennis), oan (Ornithorhynchus anatinus), ppa (Pan paniscus), ppc (Pristionchus pacificus), ppy (Pongo pygmaeus), ptr (Pan troglodytes), rno (Rattus norvegicus), sja (Schistosoma japonicum), sko (Saccoglossus kowalevskii), sla (Saguinus labiatus), sma (Schistosoma mansoni), sme (Schmidtea mediterranea), spu (Strongylocentrotus purpuratus), ssc (Sus scrofa), tca (Tribolium castaneum), tgu (Taeniopygia guttata), tni (Tetraodon nigroviridis), xla (Xenopus laevis), xtr (Xenopus tropicalis). IV.2.8 Análises estatísticas e plotagem de gráficos A análise estatística e plotagem dos gráficos boxplots foram executadas utilizando o programa R 2.12.1 (1 (“The R Project for Statistical Computing” - http://www.r-project.org/). O conjunto de dados utilizados para cada característica dos miRNAs foram obtidas utilizando PERL scripts e o programa RNAfold (Vienna package)(Hofacker, 2009). 72

(102) Predição Computacional de miRNAs em S. mansoni IV.3 Resultados e Discussão IV.3.1 Identificação de miRNAs no genoma de S. mansoni Inicialmente, as sequências do genoma e do transcriptoma de S. mansoni foram recuperadas do banco de dados GeneDB e armazenadas em formato fasta para posterior análise. As sequências do genoma de S. mansoni tem sido sequenciadas por iniciativas do TIGR (The Institute for Genomic Research) em associação com o Wellcome Trust Sanger Institute e armazenadas no banco de dados GeneDB. Em 2009, Berriman et al, publicaram um conjuntos de dados do genoma de S. mansoni abrindo novas possibilidades para exploração do parasito (Berriman et al., 2009). As sequências do transcriptoma foram sequenciadas a partir de iniciativas de sequenciamento de agências brasileiras (FAPESP e FAPEMIG) e atualmente tem sido depositadas em arquivos de contigs de ESTs também no banco de dados GeneDB (Verjovski-Almeida et al., 2003; Oliveira, 2007). O genoma de S. mansoni tem sido periodicamente atualizado no GeneDB, com novas versões de cobertura, devido ao não fechamento e não sobreposição de todas suas extremidades. A versão 4.0 do genoma continha 19022 scaffolds contemplando 8 vezes a cobertura do genoma. A última versão 5.0, diminuiu esta quantidade de scaffolds para 885 originando informações mais robustas para a pesquisa de sequências de DNA como por exemplo mapeamento provável das sequências nos cromossomos do parasito. A diminuição em número de scaffolds é relativa a montagem mais precisa das sequências do genoma do parasito. As sequências de ESTs utilizadas foram compostas por contigs provenientes de bibliotecas de cDNA de todas as fases do parasito S. mansoni. Neste trabalho, foram utilizadas para as análises aproximadamente 30000 contigs do banco de dados de ESTs e 885 cromossomos scaffolds da versão 5.0 do genoma do parasito S. mansoni (GeneDB). Para identificação de miRNAs, maduros e precursores, no genoma e transcriptoma de S. mansoni, uma abordagem computacional integrada foi desenvolvida neste trabalho. Os miRNAs preditos foram agrupados em conservados e não conservados (incluindo novos miRNAs). Para identificação destes dois grupos, inicialmente, as sequências provindas do genoma e o transcriptoma do parasito foram examinadas a fim de se obter e recuperar apenas sequências com potencial de formação de estruturas secundárias semelhantes à estrutura de pré-miRNAs (hairpins). Estudos anteriores tem mostrado a importância desta estrutura secundária característica para a formação dos pré-miRNAs e para o reconhecimento das proteínas da maquinaria de silenciamento gênico mediada por miRNAs nas células (Bentwich 73

(103) Predição Computacional de miRNAs em S. mansoni et al., 2005; Huang et al., 2007; Jiang et al., 2007). Uma das ferramentas utilizadas para identificação de miRNAs, MiRFinder, tem empregado a estrutura secundária, em forma de hairpin, como um dos critérios mais importantes para predição de miRNAs (Huang et al., 2007). Bentwich (2005) identificou miRNAs conservados e não conservados no genoma de H. sapiens considerando como um dos principais critérios e pré-requisitos para formação de uma molécula de pré-miRNAs, a estrutura em forma de hairpin. Para a obtenção de possíveis sequências com potencial para formação de estruturas em forma de grampos foram utilizados (a) einverted EMBOSS (para identificar repetições invertidas) e (b) a ferramenta blastn (para identificar estruturas semelhantes a pré-miRNAs depositados no banco de dados de miRNA miRBase). Estas duas etapas permitiram a obtenção e separação de um milhão e trezentas mil sequências com potencial formação de grampos. Estas sequências foram então, empregadas no pipeline de predição de miRNAs conservados e não conservados no genoma do parasito S. mansoni. O pipeline para predição de miRNAs conservados se baseou em diversos filtros e parâmetros eliminando falsos positivos e aumentando a acurácia da predição. Os filtros utilizados foram baseados em características de conhecidos miRNAs (precursores e maduros) como por exemplo, energia mínima livre, conteúdo de GC, posição no genoma, posição do miRNA maduro na sequência precursora grampos, entre outras (Figura 24). Trabalhos anteriores tem mostrado quão importante tem sido a utilização destas características para elucidação e predição de miRNAs conservados e não conservados em um genoma. A busca baseada em características de miRNAs maduros e precursores tem sido executada com sucesso em grupos de sequências em diferentes espécies, desde protistas até Metazoa e Plantae (Puzey and Kramer, 2009; Zhang et al., 2009c; Li et al., 2010b). Baseado nestas características, neste trabalho foi possível identificar 26 preditos prémiRNAs conservados e 35 formas maduras de miRNAs conservados. O pipeline para predição de miRNAs não conservados identificou 16 sequências de precursores e 32 sequências maduras de miRNAs (Figura 24). Este número de miRNAs identificados corrobora com o número de miRNAs depositados no miRBase referentes ao organismo próximo evolutivamente S. japonicum (55 pré-miRNAs depositados no miRNAs 16.0)(Xue et al., 2008; Copeland et al., 2009; Huang et al., 2009; Hao et al., 2010; Wang et al., 2010). Este repertório de miRNAs, referentes a espécie S. japonicum, se mostrou em grande parte representado por miRNAs espécie-específicos. Nossos resultados corroboram com os apresentados para S. japonicum mostrando a maioria dos miRNAs identificados sendo espécie-específicos. Copeland (2009) sugeriu que o baixo número de miRNAs conservados 74

(104) Predição Computacional de miRNAs em S. mansoni em S. mansoni provavelmente pode ser devido ao estilo de parasitismo específico da espécie (Copeland et al., 2009). Os miRNAs espécie-específicos encontrados neste trabalho, também podem estar associados a este estilo específico de parasitismo de S. mansoni levando a ausência de homologia com ortólogos. Os dados de miRNAs (conservados e não conservados) identificados neste trabalho foram comparados com os resultados gerados por Simões et al, 2011 (Tabela 5). Eles utilizaram três estratégias para identificação e validação dos miRNAs em S. mansoni: abordagem computacional, bibliotecas de RNA e Northern blot . A primeira estratégia foi elaborada baseada em homologia com miRNAs depositados no banco de dados miRBase. Utilizando esta estratégia, Foram identificados 15 prováveis miRNAs (maduros e precursores) no genoma de S. mansoni, dentre os quais, 3 foram identificados neste trabalho. Este número reduzido de sobreposição de resultados pode ser explicado pelo algoritmo diferenciado utilizado nos dois trabalhos. Eles também apresentaram um algoritmo utilizando todo conteúdo depositado no miRBase (versão 13.0), incluindo miRNAs de plantas, vírus e animais, enquanto nesse trabalho foram utilizados apenas miRNAs provenientes de espécies de animais depositados no miRBAse versão 16.0. Estudos anteriores têm mostrado diferenças entre os miRNAs identificados em diferentes reinos, principalmente em relação à sua biogênese, forma de repressão do alvo e padrão de conservação, sugerindo uma origem evolutiva independente das moléculas (Axtell, 2008; Lee et al., 2010). Tem sido mostrado que a conservação evolutiva dos miRNAs está inteiramente correlacionada com a sequência madura destas moléculas (Okamura et al., 2008; de Wit et al., 2009). Dentro da sequência do miRNA maduro, a região 5`, chamada de região seed (semente) (entre os nucleotídeos 2 e 8 ou 2 e 9) se destaca como a mais conservada durante a evolução importante no reconhecimento de seus alvos (Lewis et al., 2005). Esta característica é apoiada pela função destes miRNAs no pareamento de regiões 3` UTRs de RNAs mensageiros alvo silenciando e/ou reprimindo a expressão daquele gene específico. Tem sido descrito que a conservação dos alvos e atuação do miRNA maduro como molécula controladora da expressão gênica é dependente principalmente do pareamento da região seed do miRNA maduro com seu respectivo alvo (Kim et al., 2006). Considerando isto, o algoritmo deste trabalho excluiu todas as sequências com despareamento, principalmente na região seed do miRNA maduro, aumentando a especificidade e a sensibilidade do método utilizado. 75

(105) Predição Computacional de miRNAs em S. mansoni Tabela 5: Comparação entre o repertório de miRNAs identificados neste trabalho e os identificados por Simões, 2011. Gomes et al Nome Sequênia RNA biblioteca sma-mir-71 sma-mir-125a sma-bantam sma-let-7 sma-mir-212 sma-mir-124-3p sma-mir-281 UGAAAGACGAUGGUAGUGAGA UCCCUGAGACCCUUUGAUUGCC UGAGAUCGCGAUUAAAGCUGGU GGAGGUAGUUCGUUGUGUGGU UAACAGUCUACAGUCAUGGAU UAAGGCACGCGGUGAAUGUCA UGUCAUGGAGUUGCUCUCUAUA + (sma-mir-33) + (sma-miR-96) - Simoes et al, 2011 Northern blot + (miR-71) + (miR-125) + (Bantam) - Abordagem computacional + (SMan60) + (SMan36) + (SMan281) Todos miRNAs identificados neste trabalho obtiveram estrutura secundária estável, ou seja, com energia livre mínima menor que -20 kcal/mol. Além disso, todos os miRNAs maduros apresentaram um precursor com cobertura de 100% em alguma parte do genoma de S. mansoni, sem exceções. A conservação de características estruturais e termodinâmicas de miRNAs tem sido mostrada em diferentes espécies do reino animal (Zhou et al., 2009). Zhou (2009) comparou os miRNAs identificados em Equus caballus com miRNAs identificados em animais, mostrando um padrão de conservação das característica dos miRNAs. A identificação e predição de estruturas de miRNAs no genoma deve ser realizada analisando detalhadamente as características e os padrões de reconhecimento destas moléculas em determinado grupo de sequência. A escolha de características apropriadas para predição dos prováveis miRNAs permite o discernimento entre moléculas falso positivas e positivas no genoma dos organismos. IV.3.2 Identificação e Caracterização dos miRNAs maduros A identificação dos miRNAs maduros nas sequências de seus respectivos prémiRNAs tem sido considerado importantíssimo para definição da sua função no organismo (Winter et al., 2009). As formas maduras dos miRNAs podem ser processados a partir das extremidade 3` ou 5` dos pré-miRNAs (miRBase). Vários estudos, que avaliam a expressão de miRNAs maduros em amostras biológicas, tem mostrado que tanto a forma 3` quanto à forma 5` podem ter atividade biológica no organismo (miRBase). No entanto, sugere-se ocorrer uma predominância na expressão de uma das extremidades do pré-miRNAs, 3` ou 5`, dependendo da situação em que a célula se encontra(Burroughs et al., 2011; Warf et al., 2011). Além da relativa predominância de uma das extremidades expressas, a variação na sequência do miRNA maduro pode produzir sequências diferentes provindas do mesmo pré- 76

(106) Predição Computacional de miRNAs em S. mansoni miRNA, chamadas isomiRs (Burroughs et al., 2011). Nossos resultados indicam que entre os pré-miRNAs identificados, 35 foram processados a partir da extremidade 3` e 32 da extremidade 5` (Tabela 6). Estes resultados demonstram a variação de possibilidades de expressão, entre as extremidade 3`ou 5`, corroborando com dados de outras espécies. Tem sido mostrado que os miRNAs maduros possuem aproximadamente 22 nucleotídeos em sua extensão, variando em média de 20 a 25 nucleotídeos (Kim and Nam, 2006; Sharbati-Tehrani et al., 2008). Os miRNAs maduros identificados neste trabalho apresentaram em média 21,9 nucleotídeos variando de 20 a 25 nucleotídeos em extensão, corroborando com dados de espécies de animais. A tabela 6 mostra, além do tamanho de cada miRNA identificado a estrutura primária. Esta estrutura possui características singulares como a presença da porção conservada seed, como citado anteriormente. Como pode ser observado cada miRNA possui uma região seed característica (Tabela 6). Estudos tem demonstrado a presença predominante do nucleotídeo uracila na primeira posição da extremidade 5` dos miRNAs maduros. Tem sido relatado a importância desta característica para o reconhecimento dos miRNAs maduros pelo RISC (Zhang et al., 2006a; Mi et al., 2008). Neste trabalho, mais da metade dos miRNAs maduros encontrados no parasito (54%) apresentaram o nucleotídeo uracila na primeira posição (Tabela 6; Figura 25). Os resultados também indicaram alguns padrões interessantes como: freqüência de nucleotídeos em cada posição e presença discrepantes de alguns nucleotídeos em certas posições (Figura 25). 77

(107) Predição Computacional de miRNAs em S. mansoni Tabela 6: miRNAs maduros em S. mansoni. miRNA 3` ou 5` Tamanho Sequência madura (5` a 3`) Região “Seed” sma-bantam 3' 22 UGAGAUCGCGAUUAAAGCUGGU Acesso da família miRNA homólogo MIPF0000153; bantam sja-bantam sma-let-7 5' 21 GGAGGUAGUUCGUUGUGUGGU MIPF0000002; let-7 sja-let-7 sma-mir-10-3p 3' 23 AAAUUCGAGUCUAUAAGGAAAAA MIPF0000033; mir-10 sja-miR-10-3p sma-mir-10-5p 5' 22 AACCCUGUAGACCCGAGUUUGG MIPF0000033; mir-10 sja-miR-10-5p sma-mir-124-3p 3' 21 UAAGGCACGCGGUGAAUGUCA MIPF0000021; mir-124 sja-miR-124-3p sma-mir-124-5p 5' 25 CCAUUUUCCGCGAUUGCCUUGAUGA MIPF0000021; mir-124 sja-miR-124-5p sma-mir-125a 5' 22 UCCCUGAGACCCUUUGAUUGCC MIPF0000733; mir-125_2 sja-miR-125a sma-mir-190-3p 3' 20 CAGUGACCAGACAUAUCCCU MIPF0000076; mir-190 sja-miR-190-3p sma-mir-190-5p 5' 23 UGAUAUGUAUGGGUUACUUGGUG MIPF0000076; mir-190 sja-miR-190-5p sma-mir-212 3' 21 UAACAGUCUACAGUCAUGGAU MIPF0000065; mir-132 dre-miR-212 sma-mir-2162-3p 3' 21 UAUUAUGCAACGUUUCACUCU N/A sja-miR-2162-3p sma-mir-250 3' 22 CCUUCAGUUGACUCAUGAUCUC MIPF0000283; mir-250 crm-miR-250* sma-mir-281 3' 22 UGUCAUGGAGUUGCUCUCUAUA MIPF0000087; mir-46 cte-miR-281 sma-mir-2a-3p 3' 22 UCACAGCCAGUAUUGAUGAACG MIPF0000049; mir-2 sja-miR-2a-3p sma-mir-2a-5p 5' 22 CAGUCAAUAUUGGCUGAAGGCA MIPF0000049; mir-2 sja-miR-2a-5p sma-mir-2b-3p 3' 24 UAUCACAGCCCUGCUUGGGACACA MIPF0000049; mir-2 sja-miR-2b-3p sma-mir-2b-5p 5' 22 CGUCUCAAGGGACUGUGAAACA MIPF0000049; mir-2 sja-miR-2b-5p sma-mir-2c-3p 3' 22 UAUCACAGCCGUGCUUAAGGGC MIPF0000049; mir-2 sja-miR-2c-3p sma-mir-2c-5p 5' 22 UCCCUUGUUCGACUGUGAUGUG MIPF0000049; mir-2 sja-miR-2c-5p sma-mir-2d-3p 3' 22 UAUCACAGUCCUGCUUAGGUGA MIPF0000049; mir-2 sja-miR-2d-3p sma-mir-2e-3p 3' 21 UAUCACAGUCCAAGCUUUGGU MIPF0000049; mir-2 sja-miR-2e-3p sma-mir-2e-5p 5' 21 UACCAACUUUGACUGAGUUAU MIPF0000049; mir-2 sja-miR-2e-5p sma-mir-3011 5' 22 UUGAUUUUAGGGAAUUAUUUAC N/A hma-miR-3011 sma-mir-31-5p 5' 23 UGGCAAGAUUAUGGCGAAGCUGA MIPF0000064; mir-31 sja-miR-31-5p sma-mir-3479-3p 3' 22 UAUUGCACUAACCUUCGCCUUG N/A sja-miR-3479-3p sma-mir-3492 5' 21 AUCCGUGCUGAGAUUUCGUCA N/A sja-miR-3492 78

(108) Predição Computacional de miRNAs em S. mansoni sma-mir-36-3p 3' 23 CCACCGGGUAGACAUUCAUUCGC N/A sja-miR-36-3p sma-mir-61 3' 22 UGACUAGAAAGUGCACUCACUU N/A sja-miR-61 sma-mir-71 5’ 21 UGAAAGACGAUGGUAGUGAGA MIPF0000278; mir-71 sja-miR-71 sma-mir-71b-3p 3’ 21 CCUCAUACUGAGUCUUUCCCG MIPF0000278; mir-71 sja-miR-71b-3p sma-mir-71b-5p 5’ 23 UGAAAGACUUGAGUAGUGAGACG MIPF0000278; mir-71 sja-miR-71b-5p sma-mir-8-3p 3’ 23 UAAUACUGUUAGGUAAAGAUGCC MIPF0000019; mir-8 sja-miR-8-3p sma-mir-8-5p 5’ 21 CAUCUUACUAACAGUAUUUGA MIPF0000019; mir-8 sja-miR-8-5p sma-mir-92ª 5’ 22 GAUUGCACUAGUCACGGCUUUU MIPF0000013; mir-25 cte-miR-92ª sma-mir-9c 3’ 22 UCUUUGGUAUUCAAUCUGAAGA MIPF0000014; mir-9 aae-miR-9c-5p sma-mir-new_1-3p 3’ 22 GAAGCUUCGCAAUUAAACCAUC N/A N/A sma-mir-new_1-5p 5' 22 CUAAGCUGGAAGGUUUAAUCGC N/A N/A sma-mir-new_2-3p 3' 22 AGUGUUUCCAAGUUUUCCAUGG N/A N/A sma-mir-new_2-5p 5' 22 UGGAAAACCUGUGAAAGUACUG N/A N/A sma-mir-new_3-3p 3' 22 GAUUUUCUUCCUGAUGCUUCUG N/A N/A sma-mir-new_3-5p 5' 22 AUAUUUCAGAUAUUGAUUUUCU N/A N/A sma-mir-new_4-3p 3' 22 UCGCUUUACCCAUAUCUGCUAG N/A N/A sma-mir-new_4-5p 5' 22 UGCAGGUAAAGUAAUGCUUGUU N/A N/A sma-mir-new_5-3p 3' 22 AUAAUUUCAAUCUCUGAGAUUA N/A N/A sma-mir-new_5-5p 5' 22 UCCAAAGUUUCGUCCAGCAAAC N/A N/A sma-mir-new_6-3p 3' 22 UCAAUCUCCACAAUCUCAUACU N/A N/A sma-mir-new_6-5p 5' 22 CUCAGUAUGUGGUUGUGGAGGU N/A N/A sma-mir-new_7-3p 3' 22 CAGCUUAGAGAAUAACACUCCA N/A N/A sma-mir-new_7-5p 5' 22 CAGAGUUUUAUUCUUUGAUCUG N/A N/A sma-mir-new_8-3p 3' 22 UCAUACUGAUUCAGUAUGACUA N/A N/A sma-mir-new_8-5p 5' 22 AAACAUAAUCAGUGUAAACCUG N/A N/A sma-mir-new_9-3p 3' 22 AACAGCAGUAAGAUGUUUUCCU N/A N/A sma-mir-new_9-5p 5' 22 AGGGAAACGUCGUACUGUUGUA N/A N/A sma-mir-new_10-3p 3' 22 AAUUCGUCAGUUUUUGGUAAUA N/A N/A 79

(109) Predição Computacional de miRNAs em S. mansoni sma-mir-new_10-5p 5' 22 UUAUUUCCAAAACCUUGACGGA N/A N/A sma-mir-new_11-3p 3' 22 AAUUCAUCUGAAGCUGUUACAC N/A N/A sma-mir-new_11-5p 5' 22 UGAAACAGCAUUCAGAAUGAUG N/A N/A sma-mir-new_12-3p 3' 22 UUUGUUAUUGUGUUGAGCAUAU N/A N/A sma-mir-new_12-5p 5' 22 AUCACAGCUCACACACAAUUAA N/A N/A sma-mir-new_13-3p 3' 22 UUUUCUAUGAUGGUCUAGCUUC N/A N/A sma-mir-new_13-5p 5' 22 AGCUAGACUACCAUGGAAAACU N/A N/A sma-mir-new_14-3p 3' 22 AAAAACUUUCGCACCAGAUAUG N/A N/A sma-mir-new_14-5p 5' 22 UUCAUUGUCUGCGAUGAAAAAC N/A N/A sma-mir-new_15-3p 3' 22 UUCCAGGUUUCCAAUGGUGACC N/A N/A sma-mir-new_15-5p 5' 22 UGUUAAACCAUCAUUGUAAACU N/A N/A sma-mir-new_16-3p 3' 22 AUUACAAGCGAUCACUUUUAUA N/A N/A sma-mir-new_16-5p 5' 22 UGAACGUUCAUUUUAUGAACAU N/A N/A N/A – não aplicável 80

(110) Predição Computacional de miRNAs em S. mansoni Figura 25: miRNAs maduros em S. mansoni. A frequência de cada nucleotídeo (Figura Weblogo) presente nos miRNAs maduros de S. mansoni estão indicados pelos logos U (uracila), A (adenina),C (citosina), G (Guanina). As posições são indicadas pelos números no eixo x e o tamanho de cada logo indica a relativa freqüência de cada nucleotídeo naquela posição específica. Assim como os genes que codificam proteínas, os miRNAs também realizam duplicações ou contrações gênicas. Entre as formas maduras dos miRNAs conservados identificados neste trabalho, 29 foram agrupados em 16 diferentes famílias no miRBase. Estas análises foram baseadas no conteúdo de nucleotídeos da sequência madura do miRNA principalmente relativo a sua região seed (Tabela 6). O número de miRNAs encontrados em cada família de miRNAs presentes em S. mansoni variou de 1 a 9 membros. O maior número de membros por família foi encontrado na família mir-2. Essa variação tem sido também encontrada em outras espécies de animais como C. elegans. No organismo nematódeo C. elegans a família let-7 é representada por 4 miRNAs maduros compartilhando os mesmos nucleotídeos da região seed (Lim et al., 2003; Abbott et al., 2005). Tem sido relatado o envolvimento dos miRNAs desta família no controle da expressão gênica e no tempo de desenvolvimento do organismo, provavelmente silenciando alvos semelhantes devido a presença de conteúdos semelhantes na região seed (Abbott et al., 2005; Roush and Slack, 2008). Todos miRNAs conservados identificados neste trabalho mostraram 100% de identidade na região seed e no máximo 3 nucleotídeos de diferença em todo miRNA maduro em comparação com a estrutura de seu respectivo ortólogo. Como pode ser observado na tabela 6 todos miRNAs apresentaram um ortólogo correspondente em que a busca foi baseada. Os miRNAs maduros tem sido agrupados em famílias baseados em sua região seed determinando o grupo de genes que esta família irá provavelmente silenciar. A manutenção desta região conservada tem sido importante durante a evolução para manutenção dos alvos 81

(111) Predição Computacional de miRNAs em S. mansoni silenciados. Friedman, 2009 demonstrou a conservação dos alvos de miRNAs em espécies de mamíferos evidenciando a importância da conservação dos miRNAs maduros e seus respectivos alvos (Friedman et al., 2009). Neste trabalho, entre os miRNAs maduros conservados, 29 mostraram altos níveis de identidade em comparação com miRNAs representantes de S. japonicum. Alguns deles mostraram 100% de identidade considerando toda estrutura do miRNA maduro. Por exemplo, o miRNA sma-mir-8-3p apresentou o mesmo conteúdo de nucleotídeos na sua sequência quando comparado com o miRNA sjamir-8-3p de S. japonicum(Figura 26). Figura 26: Conservação de sma-mir-8 no grupo Bilateria. A alta fidelidade nos alinhamentos entre os precursores sma-mir-8 e seus respectivos ortólogos de Ecdysozoa e Lophotrochozoa foram analisadas utilizando Clustal 2.0 e RNAalifold. As formas maduras dos miRNAs são mostradas nas caixas cinza. Os respectivos grupos taxonômicos foram agrupados em colchetes. Os símbolos .)( estão relacionados a conservação dos nucleotídeos na estrutura secundária. Os parênteses indicam a presença do nucleotídeo na mesma direção na estrutura secundária. IV.3.3 Caracterização dos pré-miRNAs de S. mansoni O tamanho das moléculas de miRNA maduro e a baixa conservação em nível de nucleotídeos dos pré-miRNAs restringem a busca de miRNAs utilizando apenas métodos convencionais de alinhamento de sequências (Wang et al., 2005). No entanto, algumas características das sequências precursoras de miRNAs, como energia mínima da estrutura secundária, energia livre ajustada, conteúdo de GC e outras, tendem a seguir padrões sendo 82

(112) Predição Computacional de miRNAs em S. mansoni parâmetros utilizados para identificação e caracterização destas moléculas (Xue et al., 2005). Neste trabalho, foi possível a identificação e predição de um total de 42 pré-miRNAs no genoma de S. mansoni. Dentre estes, 26 foram preditos como conservados e 16 como não conservados. Como exposto anteriormente, a forma mais precisa para o estudo dos prémiRNAs é a observação e análise de suas características estruturais e termodinâmicas (Jiang et al., 2007; Artzi et al., 2008; Zhang et al., 2009c). Estudos anteriores tem mostrado que estas características podem fornecer informações suficientes e importantíssimas no que tange a identificação destas moléculas. Zhou (2009) identificou, no genoma de E. caballus, preditos pré-miRNAs baseado em características estruturais e termodinâmicas. Estas características foram comparadas com as características dos miRNAs de espécies de animais depositados no miRBase. Neste trabalho, as características relativas às moléculas de pré-miRNAs de S. mansoni como, tamanho, energia mínima livre (MFE), energia mínima livre ajustada (AMFE), índice de energia mínima livre (MFEI), conteúdo de GC (GC), energia mínima livre do conjunto termodinâmico (MFEE), diversidade do conjunto termodinâmico e freqüência da estrutura de energia mínima livre no conjunto termodinâmico foram utilizadas para realização de uma comparação com características provenientes de 400 pré-miRNAs encontrados em espécies do grupo Lophotrochozoa (Tabela 7). Para todas as características estudadas nenhuma diferença estatística foi encontrada entre os dois grupos analisados, com p-value > 0.05 (Tabela 7). Como podem ser observados na tabela 8 os tamanhos dos pré-miRNAs encontrados em S. mansoni variaram de 66 até 121 nucleotídeos, com média de 87 nucleotídeos por sequência. Já os precursores de espécies Lophotrochozoa apresentaram tamanhos variando de 57 até 153 nucleotídeos, com uma média de 90 nucleotídeos por sequência. Estes valores comparados entre si não apresentaram diferença estatística. Valores similares em relação ao tamanho das estruturas de pré-miRNAs foram encontrados em pré-miRNAs de animais (Zhou et al., 2009). Outra característica importante analisada foi a energia mínima livre de Gibbs que cada estrutura secundária do miRNA pode adquirir. A conservação termodinâmica de sequências de pré-miRNAs tem sido mostrada em outros estudos. Ni (2010) demonstrou a existência de uma grande correlação entre os parâmetros estruturais termodinâmicos de prémiRNAs e a conservação das sequências em diferentes genomas de animais. 83

(113) Predição Computacional de miRNAs em S. mansoni Tabela 7: Comparação das características dos pré-miRNAs de Lophotrochozoa e S. mansoni. Pre-miRNAs S. mansoni Média G (%) A (%) C (%) U (%) GC (%) AU (%) Conteúdo UA Conteúdo GC Tamanho (nt) MFE (kcal/mol) AMFE (kcal/mol) MFEI MFEE(kcal/mol) Freqüência (%) Diversidade 21.38 27.77 19.20 31.66 40.58 59.42 1.18 1.15 87.21 -32.06 -37.01 -0.92 -31.11 17.62 5.70 Desvio Padrão 3.49 4.40 3.99 4.83 5.89 5.89 0.30 0.28 10.94 5.26 5.90 0.16 5.39 12.21 2.99 Mediana 21.46 27.91 18.42 32.13 41.06 58.94 1.11 1.12 88.50 -31.35 -36.93 -0.91 -30.30 14.23 5.18 Pre-miRNAs Lophotrochozoa Média Desvio Mediana Padrão 21.31 5.05 21.08 26.91 5.69 26.98 19.19 5.09 18.81 32.58 5.60 32.67 40.49 8.96 40.00 59.49 8.94 60.00 1.26 0.32 1.21 1.15 0.29 1.12 90.29 14.57 91.00 -31.27 7.20 -30.95 -35.07 7.95 -34.83 -0.89 0.22 -0.86 -29.92 7.77 -29.70 15.16 14.38 10.13 7.30 5.66 5.92 p-value 0.93 0.34 0.99 0.30 0.95 0.96 0.12 0.98 0.18 0.49 0.12 0.29 0.33 0.29 0.07 Os precursores identificados em nosso estudo tiveram a capacidade de dobrar e gerar estruturas secundárias estáveis. Estas estruturas se mostraram como o modelo canônico de miRNAs com duas hastes em forma de duplex e uma volta ou loops na outra extremidade da sequência (“stem-loop structures”). As características termodinâmicas das estruturas secundárias destas moléculas também se mostraram dentro de valores padrões de prémiRNAs. Como pode ser observada na tabela 7, a característica MFE para as sequências de S. mansoni apresentaram média de -32 kcal por mol. O mesmo parâmetro para o grupo de prémiRNAs de Lophotrochozoa demonstrou similar valor, -31.27 kcal/mol. Estes parâmetros comparados não obtiveram diferença estatística demonstrando a similaridade entre os grupos analisados. Assim como MFE, outros parâmetros termodinâmicos e estruturais como conteúdo de GC, também não apresentaram diferença estatística comparando os grupos. Em geral, estes resultados demonstraram que as características dos pré-miRNAs são conservadas e bastante similares entre os grupos estudados. Cada característica dos pré-miRNAs, acima supracitada, foi também analisada e comparada com valores das características de pré-miRNAs de outros grupos de espécies. Foram incluídos nas análises grupos de sequências provenientes de, 77 espécies de Animais, 74 espécies de Bilatérias, 30 espécies de Ecdysozoans, 37 espécies de Deuterostômios, 7 espécies Lophotrochozoans incluindo S. japonicum. Os gráficos gerados mostraram a 84

(114) Predição Computacional de miRNAs em S. mansoni distribuição de cada característica analisada nos diversos grupos de sequências. Ni (2010) mostrou a distribuição de valores associados a características de pré-miRNAs em 3 grupos de sequências provenientes de humanos, camundongos e galinha. Foi identificado uma correlação entre as características dos pré-miRNAs e a conservação destas sequências. Neste trabalho, ficou evidente a conservação das características dos pré-miRNAs identificados em S. mansoni em comparação com pré-miRNAs em espécies de Lophotrochozoa (Figuras 27 e 28). Como pode ser visto nas figuras 27 e 28, existe um padrão de conservação das características estruturais e termodinâmicas dos pré-miRNAs analisados nestes dois grupos de sequência. Figura 27: Características estruturais e termodinâmicas de pré-miRNAs. Os valores utilizados (A) MFE, (B) AMFE, (C) MFEI e (D) Conteúdo de GC foram baseados nos prémiRNAs depositados no banco de dados miRBase provenientes de diferentes grupos de espécies como Animais, Bilateria, Deuterostômios, Ecdysozoa, Lophotrochozoa, S. japonicum assim como dos pré-miRNAs identificados neste trabalho. As caixas representam 50% dos dados analisados. A extremidade mais baixa do e Box plot é o primeiro quartil ou 25 % e a extremidade mais alta representa o terceiro quartil ou 75 %. A linha horizontal dentro da caixa representa a mediana e os valores maiores que 1,5 vezes a mediana são os “outliers”. 85

(115) Predição Computacional de miRNAs em S. mansoni Figura 28: Características estruturais e termodinâmicas de pré-miRNAs. Os valores utilizados (A) MFEE, (B) Diversidade do conjunto termodinâmico, (C) Freqüência da estrutura de energia mínima livre no conjunto termodinâmico e (D) Tamanho foram baseados nos pré-miRNAs depositados no banco de dados miRBase provenientes de diferentes grupos de espécies como Animais, Bilateria, Deuterostômios, Ecdysozoa, Lophotrochozoa, S. japonicum assim como dos pré-miRNAs identificados neste trabalho. As caixas representam 50% dos dados analisados. A extremidade mais baixa do e Box plot é o primeiro quartil ou 25 % e a extremidade mais alta representa o terceiro quartil ou 75 %. A linha horizontal dentro da caixa representa a mediana e os valores maiores que 1,5 vezes a mediana são os “outliers”. As características de cada um dos pré-miRNAs identificados no genoma de S. mansoni foram importantes para predição. A tabela 8 mostra os valores de cada característica destes miRNAs. Os pré-miRNAs conservados foram encontrados apenas nas sequências genômicas de S. mansoni enquanto os não conservados foram encontrados em ambos os bancos de dados, genoma e ESTs (Tabela 8). A presença de miRNAs em ESTs tem sido evidenciada em bibliotecas de cDNA de vários organismos como verificada em humanos (Li et al., 2006). 86

(116) Predição Computacional de miRNAs em S. mansoni Tabela 8: Pré-miRNAs de S. mansoni e suas características estruturais e termodinâmicas. miRNA Conteúdo de GC (%) Tamanho MFE AMFE (nt) kcal/mol kcal/mol MFEI MFEE Frequência Diversidade kcal/mol (%) (%) EST sma-bantam 42,25 71 -26,40 -37,18 -0,88 -26,40 37,57 2,64 N/A sma-let-7 42,70 89 -34,30 -38,54 -0,90 -27,50 1,21 10,72 N/A sma-mir-10 41,77 79 -27,80 -35,19 -0,84 -27,60 29,74 4,84 N/A sma-mir-124 37,63 93 -28,30 -30,43 -0,81 -28,10 5,80 7,77 N/A sma-mir-125a 43,90 82 -30,90 -37,68 -0,86 -30,20 31,96 2,30 N/A sma-mir-190 40,50 121 -44,80 -37,02 -0,91 -44,70 4,46 5,01 N/A sma-mir-212 34,48 87 -21,50 -24,71 -0,72 -20,50 7,10 6,21 N/A sma-mir-2162 44,74 76 -34,90 -45,92 -1,03 -34,30 9,12 4,72 N/A sma-mir-250 36,00 100 -44,40 -44,40 -1,23 -44,40 20,54 2,83 N/A sma-mir-281 34,69 98 -36,60 -37,35 -1,08 -34,40 9,43 15,87 N/A sma-mir-2a 46,15 78 -39,00 -50,00 -1,08 -39,00 50,78 1,77 N/A sma-mir-2b 54,43 79 -35,20 -44,56 -0,82 -35,00 31,80 3,74 N/A sma-mir-2c 48,00 75 -27,62 -36,83 -0,77 -27,62 33,73 3,13 N/A sma-mir-2d 37,50 88 -30,80 -35,00 -0,93 -30,80 17,43 5,26 N/A sma-mir-2e 39,76 83 -25,00 -30,12 -0,76 -24,40 18,86 9,30 N/A sma-mir-3011 33,67 98 -38,50 -39,29 -1,17 -37,70 13,64 4,09 N/A sma-mir-31 42,17 83 -33,30 -40,12 -0,95 -32,40 11,34 7,36 N/A sma-mir-3479 38,16 76 -28,80 -37,89 -0,99 -28,19 8,67 5,92 N/A sma-mir-3492 48,35 91 -27,00 -29,67 -0,61 -26,70 23,79 3,77 N/A sma-mir-36 44,68 94 -37,45 -39,84 -0,89 -37,25 3,26 5,85 N/A sma-mir-61 43,88 98 -29,90 -30,51 -0,70 -28,16 6,56 10,83 N/A 87

(117) Predição Computacional de miRNAs em S. mansoni sma-mir-71 51,25 80 -34,50 -43,13 -0,84 -34,50 41,47 1,94 N/A sma-mir-71b 53,26 92 -31,40 -34,13 -0,64 -25,14 5,00 11,21 N/A sma-mir-8 34,21 76 -25,70 -33,82 -0,99 -25,70 18,69 5,04 N/A sma-mir-92a 43,66 71 -25,00 -35,21 -0,81 -25,00 28,79 3,17 N/A sma-mir-9c 31,31 99 -30,20 -30,51 -0,97 -29,67 8,28 6,21 N/A sma-mir-new_1 40,82 98 -36,4 -37,14 -0,91 -30,4 12,36 5,44 Sm24375 sma-mir-new_2 41,30 92 -37,50 -40,76 -0,99 -37,2 14,83 5,81 Sm01360 sma-mir-new_3 34,34 99 -28,90 -29,19 -0,85 -25,4 3,05 9,67 Sm02419 sma-mir-new_4 43,30 97 -32,89 -33,91 -0,78 -32,89 5,83 6,08 Sm04679 sma-mir-new_5 30,30 99 -32,30 -32,63 -1,08 -32,3 39,36 3,03 Sm05165 sma-mir-new_6 36,67 90 -35 -38,89 -1,06 -34,4 16,07 7,87 Sm12132 sma-mir-new_7 32,10 81 -28,60 -35,31 -1,10 -28,6 20,58 3,34 Sm01328 sma-mir-new_8 44,44 81 -31,3 -38,64 -0,87 -31,3 21,03 2,77 Sm20488 sma-mir-new_9 45,45 66 -32,6 -49,39 -1,09 -31,64 30,25 2,51 Sm21666 sma-mir-new_10 35,44 79 -27,6 -34,94 -0,99 -27,5 22,31 5,1 Sm22883 sma-mir-new_11 40,28 72 -28,2 -39,17 -0,97 -25,95 8,59 6,92 Sm29317 sma-mir-new_12 41,94 93 -26,3 -28,28 -0,67 -26,11 11,12 9,63 Sm25456 sma-mir-new_13 37,50 80 -41,60 -52,00 -1,39 -39,9 27,78 3,82 Sm05979 sma-mir-new_14 43,00 100 -36,50 -36,50 -0,85 -36,5 5,74 5,94 Sm08219 sma-mir-new_15 38,20 89 -29,4 -33,03 -0,86 -29,2 11,66 5,65 Sm18604 sma-mir-new_16 30,00 90 -32,1 -35,67 -1,19 -32,1 10,44 4,27 Sm25070 MFE: Energia mínima livre AMFE: Energia mínima livre ajustada MFEI: Índice de energia mínima livre MFEE: Energia mínima livre do conjunto. 88

(118) Predição Computacional de miRNAs em S. mansoni IV.3.4 Distribuição dos genes de miRNAs no genoma de S. mansoni Tem sido mostrado a presença de miRNAs em 3 regiões distintas do genoma: intergênicas, intrônicas e regiões não traduzidas (UTRs) (Lagos-Quintana et al., 2003; Kim and Nam, 2006; Li et al., 2007; Cai et al., 2011). Lagos-Quintana (2003) identificou novos miRNAs em humanos e camundongos localizados nas 3 regiões. Além disso, foi demonstrado que a região com maior número de miRNAs foi a região intergênica com mais de 50% dos genes. Cai (2011) demonstrou a presença de miRNAs nestas três regiões em S. japonicum. Foi identificado um número maior de miRNAs nas regiões intergênicas, seguido pelas regiões intragênicas e por último as UTRs. Os pré-miRNAs preditos neste trabalho, foram buscados e localizados no genoma de S. mansoni nas três regiões supracitadas (Tabela 9). A ausência de pré-miRNAs em regiões codificadoras de proteínas no genoma do parasito se deve ao fato dos filtros do pipeline excluírem as regiões codificadoras de proteínas nas análises. Neste trabalho dentre os 42 pré-miRNAs identificados no genoma de S. mansoni 30 foram encontrados em regiões intergênicas, 11 em regiões intrônicas e um em região 3`UTR (Tabela 9). Como todas as regiões que codificavam prováveis proteínas foram excluídas das análises os dados não refletem a presença destes miRNAs nestas regiões. A presença de miRNAs em regiões intrônicas tem sido demonstrada em trabalhos anteriores como o mir190 na região intrônica do gene talin. A presença deste gene, mir-190, nesta região intrônica do gene talin tem sido demonstrada ser conservada desde coanoflagelados, protistas aquáticos como Monosiga brevicollis, até os seres humanos (Campo-Paysaa et al., 2011). Todos os prémiRNAs identificados não apresentaram mais de uma posição no genoma como mostrado na tabela 9. A orientação da fita correspondente a cada precursor não seguiu um padrão, sendo 26 pré-miRNAs dirigidos pela fita positiva do DNA e 18 pela fita negativa (Tabela 9). 89

(119) Predição Computacional de miRNAs em S. mansoni Tabela 9: Localização dos preditos pré-miRNAs no genoma e nos cromossomos scaffolds de S. mansoni. miRNA Cromossomo Scaffold Genoma - Genoma Fita Início - Fim Orientação Região gênica sma-bantam Schisto_mansoni.SC_0137 369443 369513 (+) Intergênica sma-let-7 Schisto_mansoni.Chr_7 5118783 5118871 (+) Intergênica sma-mir-10 Schisto_mansoni.Chr_4 19959268 19959346 (-) Intergênica sma-mir-124 Schisto_mansoni.Chr_6 18429525 18429617 (-) Intergênica sma-mir-125a Schisto_mansoni.Chr_1 38691263 38691344 (-) Intergênica sma-mir-190 Schisto_mansoni.Chr_1 34471102 34471222 (+) Intrônica- Smp_037860 sma-mir-212 Schisto_mansoni.Chr_2 29111488 29111574 (-) Intrônica- Smp_143490 sma-mir-2162 Schisto_mansoni.SC_0049 36185 36260 (+) Intergênica sma-mir-250 Schisto_mansoni.SC_0125 24702 24801 (+) Intergênica sma-mir-281 Schisto_mansoni.Chr_4 27195935 27196032 (-) Intergênica sma-mir-2a Schisto_mansoni.Chr_W 22875749 22875826 (+) Intergênica sma-mir-2b Schisto_mansoni.Chr_W 22875844 22875922 (+) Intergênica sma-mir-2c Schisto_mansoni.Chr_5 1982423 1982497 (-) Intergênica sma-mir-2d Schisto_mansoni.Chr_5 1982526 1982613 (-) Intergênica sma-mir-2e Schisto_mansoni.Chr_W 22875945 22876027 (+) Intergênica sma-mir-3011 Schisto_mansoni.SC_0250 146496 146593 (-) Intrônica- Smp_146450 sma-mir-31 Schisto_mansoni.Chr_6 1777481 1777563 (-) Intergênica sma-mir-3479 Schisto_mansoni.Chr_4. unplaced.SC_0032 1561284 1561359 (-) Intrônica- Smp_148850 sma-mir-3492 Schisto_mansoni.Chr_W 8158491 8158581 (+) Intrônica- Smp_126330 sma-mir-36 Schisto_mansoni.Chr_1 57476968 57477061 (-) Intergênica 90

(120) Predição Computacional de miRNAs em S. mansoni sma-mir-61 Schisto_mansoni.Chr_2 25390606 25390703 (+) Intergênica sma-mir-71 Schisto_mansoni.Chr_W 22875655 22875734 (+) Intergênica sma-mir-71b Schisto_mansoni.Chr_5 1982759 1982850 (-) Intergênica sma-mir-8 Schisto_mansoni.Chr_1 10044867 10044942 (-) Intergênica sma-mir-92a Schisto_mansoni.Chr_3 22956805 22956875 (-) Intergênica sma-mir-9c Schisto_mansoni.Chr_2 21913217 21913315 (+) Intergênica sma-mir-new_1 Schisto_mansoni.Chr_3 24540256 24540353 (+) Intrônica- Smp_132570 sma-mir-new_2 Schisto_mansoni.Chr_6 4070791 4070882 (+) Intergênica sma-mir-new_3 Schisto_mansoni.Chr_3 13891083 13891181 (+) Intergênica sma-mir-new_4 Schisto_mansoni.Chr_2. unplaced.SC_0120 6469 6565 (-) Intergênica sma-mir-new_5 Schisto_mansoni.Chr_W 24055623 24055721 (+) Intergênica sma-mir-new_6 Schisto_mansoni.Chr_7. unplaced.SC_0100 956192 956281 (-) Intrônica- Smp_144770 sma-mir-new_7 Schisto_mansoni.Chr_7 789769 789849 (+) 3'UTR- Smp_097370 sma-mir-new_8 Schisto_mansoni.Chr_5 2556921 2557001 (-) Intrônica- Smp_153410 sma-mir-new_9 Schisto_mansoni.Chr_W 36376729 36376794 (+) Intrônica- Smp_135850 sma-mir-new_10 Schisto_mansoni.Chr_2 8470212 8470290 (+) Intergênica sma-mir-new_11 Schisto_mansoni.Chr_2 28915165 28915236 (+) Intrônica- Smp_143550 sma-mir-new_12 Schisto_mansoni.Chr_W 3892016 3892108 (+) Intergênica sma-mir-new_13 Schisto_mansoni.SC_0041 1513726 1513805 (+) Intergênica sma-mir-new_14 Schisto_mansoni.Chr_W 54858104 54858203 (-) Intrônica- Smp_136490 sma-mir-new_15 Schisto_mansoni.Chr_W 30576111 30576199 (-) Intergênica sma-mir-new_16 Schisto_mansoni.Chr_W 35229680 35229768 (+) Intergênica 91

(121) Predição Computacional de miRNAs em S. mansoni Em termos de distribuição cromossômica, os pré-miRNAs identificados foram distribuídos em todos os 7 cromossomos autossômicos do parasito e no cromossomo sexual W. A ausência de miRNAs no cromossomo sexual Z corrobora com resultados encontrados em outras espécies como por exemplo em seres humano. Diversos trabalhos têm mostrado ausência desta classe de molécula no cromossomo sexual Y (Mishima et al., 2008; Kozomara and Griffiths-Jones, 2011). Neste caso, vale ressaltar que em seres humanos, o gênero homogamético é a fêmea, XX, e no caso do parasito S. mansoni é o macho, ZZ. Sendo assim, os miRNAs expressos no cromossomo sexual W, presentes apenas em fêmeas do parasito, serão considerados gênero específico. Isto não ocorre em seres humanos, pois tanto o macho quanto a fêmea possuem cromossomo X. Esta informação é importantíssima para o estudo da relação entre os miRNAs sexo específicos preditos no parasito fêmea e seus respectivos alvos. A Figura 29 mostra a posição de cada miRNA nos cromossomos scaffolds de S. mansoni na versão 5.0 do genoma. Alguns miRNAs foram localizados em scaffolds não mapeados com um cromossomo específico e assim não indicados na figura 29. O cromossomo que mostrou maior número de miRNAs, ou seja, maior densidade cromossômica em relação aos miRNAs, foi o cromossomo W (Figura 29). Estes resultados corroboram com o repertório de miRNAs encontrado em humanos (miRBase v 16.0) que mostra a presença de mais de 9% do total dos miRNAs presentes no cromossomo X. Estudos recentes tem mostrado esta mesma tendência (maior densidade de miRNAs no cromossomo X) em 8 diferentes espécies de mamíferos (Guo et al., 2009; Song et al., 2009). Foi também demonstrado, em humanos, que estes miRNAs, alocados no cromossomo X, tem uma alta transcrição na gametogênese sugerindo uma importante função dos miRNAs ligados ao cromossomo X nesta situação (Song et al., 2009). 92

(122) Predição Computacional de miRNAs em S. mansoni Figura 29: Distribuição dos preditos miRNAs nos cromossomos scaffolds de S. mansoni. A localização relativa de cada pré-miRNAs nos cromossomos de S. mansoni (versão 5.0) mostrou a presença destes em 7 cromossomos autossômicos e um cromossomo sexual (W). As linhas pretas representam os pré-miRNAs em suas respectivas posições. As setas indicam a presença dos dois clusteres encontrados em S. mansoni: sma-mir-71/2 e sma-mir71b/2. IV.3.5 Análise dos miRNAs conservados Neste trabalho foram identificados 26 pré-miRNAs conservados sendo 19 destes pertencentes a alguma família conhecida de miRNA (Figura 30). A figura 30 mostra a distribuição destes miRNAs em diferentes grupos taxonômicos. Todos os miRNAs representados mostraram conservação em espécies de Deuterostômios e Protostômios incluindo S. mansoni. O miRNA let-7 se mostrou conservado e presente em todos os clados estudados de Deuterostômios e Protostômios. O miRNA mir-124 tem sido encontrado altamente conservado nas espécies de Animais. Essa conservação, ao nível de nucleotídeos do miRNA maduro, apresentou identidade próxima de 100% comparando sequências de Superfilos distintos como seres humanos e S. mansoni. Esta semelhança não reflete apenas nos genes alvos que estas moléculas irão almejar, mas também sua regulação, estabilidade e 93

(123) Predição Computacional de miRNAs em S. mansoni tempo de meia vida no organismo. No entanto, os mecanismos que controlam estas características tem sido pouco entendidas (Winter et al., 2009). Figura 30: Distribuição filogenética dos miRNAs em genomas animais. Os miRNAs conservados encontrados em S. mansoni foram comparados com seus respectivos ortólogos em espécies de animais. “X” indica a presença do miRNA em ao menos uma espécie dentro do clado. Os quadros acima apresentam os nomes de cada família de miRNA. A filogenia simplificada foi baseada em Jones e Blaxter, 2005 (Jones and Blaxter, 2005). Sempere (2010) demonstrou que a distribuição taxonômica dos miRNAs tem estado estreitamente correlacionada com a distribuição taxonômica dos animais. As análises filogenéticas e de alinhamentos das sequências da família mir-8, mir-10 e mir-71 nos grupos Lophotrochozoa, Ecdysozoa e Deuterostômios mostraram em geral que as respectivas sequências de miRNAs encontradas em S. mansoni agruparam de acordo com a distribuição taxonômica dos animais. Além disso, um dos miRNAs encontrados em regiões intrônicas, sma-mir-190, mostrou distribuição conservada em relação a espécies Bilateria dentro do gene talin. IV.3.5.1 mir-190 de S. mansoni O mir-190 tem sido encontrado em regiões intrônicas do gene talin em diversas espécies tais como H. sapiens, Lottia gigantea, B. floridae, Nematostella vectensis e Monosiga brevicollis. A estrutura gênica do gene talin juntamente com o mir-190 tem 94

(124) Predição Computacional de miRNAs em S. mansoni mostrado alta conservação em organismos distantes filogeneticamente como coanoflagelata, Monosiga brevicollis e seres humanos. Campo-Paysaa (2011) mostrou que mir-190 é um miRNA específico de espécies Bilatérias por não ser encontrado em organismos fora do clado, embora talin seja parte do repertório de genes destes organismos. Neste trabalho, análises no genoma do parasito revelaram que sma-mir-190 está localizado dentro do predito gene talin entre os éxons 7 e 8. Esta distribuição entre éxons do gene talin não tem uma conservação característica. Por exemplo, em camundongos o miR-190 está posicionado no íntron 51, entre os éxons, 50 e 51, enquanto em D. melanogaster o miRNA está posicionado no íntron 12, entre os éxons 11 e 12 (mirBase) (Debrand et al., 2009). Assim como em S. mansoni, o representante ortólogo sja-mir-190, encontrado em S. japonicum, foi localizado em um íntron do predito gene talin (Sjp_0006570.1). O precursor sma-mir-190 mostrou 90% de identidade, ao nível de nucleotídeos, quando comparado com o precursor sja-mir-190,. Entretanto, as partes maduras de ambos mostraram 100% de identidade (Figura 31a). As estruturas secundárias de sma-mir190 e sja-mir-190 mostraram grandes semelhanças como pode ser confirmado pela estrutura secundária consenso na figura 31b. Figura 31: Análise estrutural comparativa entre sma-mir-190 e sja-mir-190. (A) O alinhamento global das estruturas secundárias dos precursores sma-mir-190 e sja-mir-190 foram realizados utilizando os programas ClustalX 2.0 e RNAalifold. Os miRNAs maduros mir-190-3p e mir-190-5p foram mostrados no alinhamento dentro de caixas tracejadas. (B) O 95

(125) Predição Computacional de miRNAs em S. mansoni dobramento consenso das estruturas secundárias dos precursores sja-mir-190 e sma-mir-190 foi realizado utilizando RNAalifold. Os miRNAs maduros foram representados em uma caixa amarela. IV.3.5.2 miRNA-8 de S. mansoni A versão do miRBase 16.0 indica que a família mir-8 tem sido composta por 4 membros de miRNAs: mir-8, mir-200, mir-141 e mir-429. Neste estudo, os ortólogos do gene mir-8 foram encontrados somente em espécies de Protostômios (Lophotrochozoans e Ecdysozoans) incluindo S. mansoni. Por outro lado os pré-miRNAs, mir-429, mir-200 e mir141 foram encontrados apenas em espécies do Superfilos Deuterostômios (Figura 26). Estes resultados corroboram com Sempere (2010) que demonstrou que o microRNA mir-8 tem sido considerado um gene presente apenas em organismos do grupo Protostômios, ou seja, Protostômios-específicos. Neste mesmo trabalho, Sempere mostrou que os microRNAs, mir141 e mir-200, podem ser considerados Deuterostômios-específicos, sendo encontrados apenas no Superfilo Deuterostômios. Os miRNAs da família mir-8 tem sido encontrados em formas de clusteres em organismos dentro do grupo Cordata (Campo-Paysaa et al., 2011). Esta informação tem sido considerada mais relevante para os miRNAs da família mir-8 encontrados em Deuterostômios e não em Protostômios. O sma-mir-8 foi encontrado fora de um cluster no genoma de S. mansoni, corroborando com ortólogos proveniente de organismos Protostômios. Este gene foi encontrado dentro do grupo de organismos pertencentes ao grupo dos Platelmintos corroborando com a distribuição taxonômica das espécies (Figura 32) 96

(126) Predição Computacional de miRNAs em S. mansoni Figura 32: Distribuição evolutiva do miRNA sma-mir-8 no grupo Bilateria (a) As relações filogenéticas foram referidas entre os precursores sma-mir-8 e seus homólogos. A árvore filogenética foi gerada utilizando o método Neighbor-Joining, e o modelo Kimura-2parâmetros, ambos executados no programa MEGA 4.0. Os clados distintos apresentaram os grupos Deuterostômios (miR-429, miR-200 and mir-141 genes) e o grupo Ecdysozoa /Lophotrochozoa (mir-8 gene). Somente os “bootstrap” acima de 30 foram considerados para 2000 réplicas analisadas. O alinhamento múltiplo de sequência dos pré-miRNAs mir-8confirmou a conservação entre espécies de Lophotrochozoa e Ecdysozoa. Além disso, foram identificados nucleotídeos 97

(127) Predição Computacional de miRNAs em S. mansoni conservados entre as formas maduras de miRNAs presentes nos precursores mir-8 (formas mir-8-5p e mir-8-3p) principalmente na região “seed” (Figura 26). IV.3.5.3 mir-10 de S. mansoni Os membros da família mir-10 tem sido encontrados em todas as espécies de animais depositadas no banco de dados de miRNAs miRBase. Neste trabalho, o estudo filogenético desta família de miRNAs, mostrou que sma-mir-10, agrupou juntamente com pré-miRNAs provenientes de espécies do grupo Lophotrochozoa. Esta distribuição corrobora com a distribuição taxonômica das espécies no qual o parasito S. mansoni se enquadra. O gene sjamir-10 foi encontrado juntamente com sma-mir-8 entre os grupos de espécies Ecdysozoans e Deuterostômios (Figura 33). Na maioria das espécies pertencentes ao grupo Bilateria, mir-10 tem sido encontrado em um cluster juntamente com genes HOX. No caso específico dos seres humanos, dois genes da família mir-10 tem sido encontrados próximos a 4 genes HOX (Lemons and McGinnis, 2006; Campo-Paysaa et al., 2011). Em S. mansoni, o gene mir-10 foi encontrado 70kb a jusante do gene SmHOX4 (Smp_166140), um dos 4 genes HOX encontrados no genoma do parasito, corroborando com os dados anteriores de H. sapiens. O número reduzido de genes HOX no parasito, quando comparado com outras espécies pertencentes ao grupo Lophotrochozoa, está diretamente correlacionado com a arquitetura axial simplificada do parasito (Pierce et al., 2005; Berriman et al., 2009). Utilizando alinhamento múltiplo de sequência entre representantes de espécies do clado Lophotrochozoa e Ecdysozoa foi possível observar uma alta conservação de sma-mir-10 e seus ortólogos, principalmente na região seed de sma-mir-10-5p e sma-mir-10-3p (Figura 33b). Específicamente, sma-mir-10-5p e sja-mir-10-5p apresentaram 100% de identidade ao nível de nucleotídeos (Figura 33b). A conservação da seqüência de nucleotídeos do miRNA maduro reflete a importância destas pequenas moléculas para o funcionamento celular correto. 98

(128) Predição Computacional de miRNAs em S. mansoni A 99

(129) Predição Computacional de miRNAs em S. mansoni B Figura 33: Conservação do miRNA sma-mir-10 no grupo Bilateria (a) As relações filogenéticas foram referidas entre os precursores sma-mir-10 e seus ortólogos. A árvore filogenética foi gerada utilizando o método Neighbor-Joining, e o modelo Kimura-2parâmetros, ambos executados no programa MEGA 4.0. Os clados distintos apresentaram os grupos Deuterostômios, Ecdysozoa e Lophotrochozoa. Somente os “bootstraps” acima de 30 foram considerados para 2000 replicas analisadas. (b) A alta fidelidade nos alinhamentos entre os precursores sma-mir-10 e seus respectivos ortólogos de Ecdysozoa e Lophotrochozoa foram realizadas usando Clustal 2.0 e RNAalifold. As formas maduras dos miRNAs são mostradas nas caixas cinza. IV.3.6 Duplicações dos miRNAs 71 e 2 em S. mansoni Eventos de duplicação gênica têm sido encontrados em diversas espécies e com diferentes grupos de sequências. A ocorrência de duplicações em genes de miRNAs tem sido reportada em vários trabalhos em diversas espécies (Tanzer and Stadler, 2004; Hertel et al., 2006; Maher et al., 2006). As duplicações gênicas em miRNAs tem sido divididas em duas classes e facilmente distinguidas. A primeira classe reporta genes de miRNAs que sofreram uma duplicação gênica local “in tandem”, ou seja, resultando em parálogos provavelmente co-localizados no mesmo transcrito. Estes genes provavelmente mantêm uma disposição cromossômica constante durante a evolução permitindo estar fisicamente ligados (in linkage). A segunda classe reporta genes que sofreram duplicações não locais dentro do mesmo genoma resultando em parálogos encontrados em diferentes cromossomos. Neste caso, a conservação evolutiva tem sido menos pronunciada. Esta duplicação pode ocorrer também 100

(130) Predição Computacional de miRNAs em S. mansoni por um bloco de sequências no genoma como acontece em duplicações gênicas envolvendo um cluster completo de miRNAs (Hertel et al., 2006). Neste trabalho, foram encontrados duplicatas gênicas dos representantes das famílias mir-2 e mir71. Uma análise pontual de cada família revela os dois tipos de duplicações ocorrendo em S. mansoni, tanto a local quanto a não local. Espécies relativamente próximas evolutivamente dentro do grupo Protostômios apresentam diferentes disposições destes genes no genoma. Um exemplo comparativo é o caso destes genes em C. elegans. O nematódeo C. elegans apresenta estas duas famílias gênicas ligadas em um cluster, mas com a composição de apenas um miRNA de cada família, cel-miR-2 e cel-miR-71. Quando comparado com C. elegans, S. mansoni demonstrou a presença de duplicações gênicas. Tanto os miRNAs provenientes da família mir-2 quanto mir-71 apresentaram duplicações gênicas não locais, apresentando parálogos distantes no genoma, em diferentes cromossomos. No entanto, apenas os representantes da família mir-2 em S. mansoni apresentaram também duplicações locais como pode ser observado nas posições e localização cromossômica destes genes (Tabela 9). Os miRNAs da família mir-2 foram encontrados em quase todas as espécies de Protostômios (Lophotrochozoans e Ecdysozoans). O número de cópias destes genes e a similaridade entre eles variam de espécie para espécie. Em S. mansoni os representantes da família mir-2 foram sma-mir-2a, sma-mir-2b, sma-mir-2c, sma-mir-2d e sma-mir-2e. Os miRNAs maduros sma-mir-2b-3p, sma-mir-2c-3p, sma-mir-2d-3p e sma-mir-2b-3p apresentaram um alto grau de similaridade principalmente na região seed, com 100% de identidade. A análise filogenética dos miRNAs da família mir-71 mostrou uma distribuição dos genes parálogos e ortólogos na escala evolutiva (Figura 34). Um dos representantes desta família, identificado em S. mansoni, sma-mir-71, apresentou alto grau de conservação quando comparado com os miRNAs dos Platelmintos, S. mediterranea (sme-mir-71c) e S. japonicum (sja-mir-71) demonstrando distribuição taxonômica semelhante a distribuição das espécies (Figura 34). Da mesma família de sma-mir-71, o miRNA sma-mir-71b, agrupou no mesmo clado do ortólogo encontrado em S. japonicum, sja-mir-71b, mas entre os clados de espécies pertencentes aos grupos Ecdysozoa e Deuterostômios (Figura 34a). Tanto S. mediterranea quanto S. japonicum (ambos Platelmintos) mostraram duplicações gênicas semelhantes a S. mansoni nas duas famílias de miRNAs (mir-71 e mir2). S. mediterranea apresentou 4 estruturas de cluster mir-71/2 e S. japonicum apresentou 2 estruturas como S. mansoni. Os miRNAs sma-mir-71 e sma-mir71b apresentaram alta 101

(131) Predição Computacional de miRNAs em S. mansoni similaridade quando comparado com seus ortólogos em Ecdysozoans e Lophotrochozoans (Figura 34b). As partes mais conservadas nas sequências dos precursores foram as regiões seed dos miRNAs maduros corroborando com alinhamentos de outras famílias de miRNAs como mir-10. A gênese da duplicação dos miRNAs da família mir-71 sugere que esta duplicação pode ter sido gerada antes da divergência das espécies de Platelmintos na evolução. Esta hipótese será testada no capítulo V. A 102

(132) Predição Computacional de miRNAs em S. mansoni B Figura 34: Conservação do miRNA dos genes sma-mir-71 e sma-mir-71b no grupo Bilateria. (a) As relações filogenéticas foram referidas entre os precursores da família mir71. A árvore filogenética foi gerada utilizando o método Neighbor-Joining, e o modelo Kimura-2-parâmetros, ambos executados no programa MEGA 4.0. Os clados distintos apresentaram os grupos Deuterostômios (Cephalochordata, Echinodermata e Hemichordata), Ecdysozoa e Lophotrochozoa. Somente os “bootstraps” acima de 30 foram considerados para 2000 replicas analisadas. (b) A alta fidelidade nos alinhamentos entre os precursores smamir-71, sma-mir-71b e seus respectivos ortólogos de Ecdysozoa e Lophotrochozoa foram realizadas usando Clustal 2.0 e RNAalifold. As formas maduras dos miRNAs são mostradas nas caixas cinza. IV.3.7 Clusteres mir-71/2 e mir-71b/2 Os clusteres de miRNAs tem sido encontrados em camundongos, humanos e muitas outras espécies (Tanzer and Stadler, 2004; Noguer-Dance et al., 2010). Os pré-miRNAs são considerados agrupados no mesmo cluster se eles estiverem distantes um do outro menos que 10 mil pares de base (miRBase). Seguindo este critério, sete pré-miRNAs foram identificados como parte de dois clusteres no genoma de S. mansoni. O primeiro cluster foi encontrado contendo quatro pré-miRNAs: sma-mir-71, sma-mir-2a, sma-mir-2b e sma-mir-2e; e o segundo contendo 3 pré-miRNAs sma-mir-71b, sma-mir-2c e sma-mir-2d (Figura 35). Ambos os clusteres contem pelo menos um membro da família mir-71 e um membro da família mir-2, corroborando com dados do mesmo cluster em espécies de Ecdysozoa e 103

(133) Predição Computacional de miRNAs em S. mansoni Lophotrochozoa. A mesma organização e distribuição dos ortólogos nos clusteres foram encontradas no parasito S. japonicum (Huang et al., 2010; Wang et al., 2010). A distribuição destes clusteres nos cromossomos do parasito S. mansoni mostrou a presença do cluster sma-71/2 no cromossomo sexual W e cluster parálogo, sma-mir-71b/2, foi encontrado no cromossomo autossômico 5. O cromossomo sexual W está presente apenas em fêmeas da espécie de S. mansoni sugerindo a presença de um cluster de miRNAs gênero específico neste parasito (Figura 35). A presença de miRNAs gênero-específico em relação a posição no genoma não tinha sido relatada anteriormente. Tem sido reportado e considerado miRNAs gênero específicos aqueles com alta expressão em um gênero, macho ou fêmea (Mishima et al., 2008). Mishima (2008) utilizando biblioteca de pequenos RNAs apresentou diferentes perfis de expressão de miRNAs em testículos e ovários de camundongos. No mesmo trabalho, foram mostrados aproximadamente 45 miRNAs distintamente expressos em ovário e 35 em testículos, evidenciando a presença de miRNAs gênero-específicos. A expressão de miRNAs específicos em determinado gênero sugere uma provável participação, destas moléculas, no desenvolvimento sexual do organismo (Mishima et al., 2008). Figura 35: Clusteres de miRNAs no genoma de S. mansoni. As estruturas secundárias dos clusteres sma-mir-71/2 e sma-mir-71b/2 foram realizadas por RNAfold (Hofacker, 2009). A posição nos cromossomos, tamanho e direção da fita são mostradas nas caixas cinza abaixo da figura. Visto a importância biológica destas moléculas no controle da expressão gênica envolvendo seus potenciais alvos, assim como a diversidade de arranjos destas moléculas nos 104

(134) Predição Computacional de miRNAs em S. mansoni organismos, os próximos capítulos enfatizarão 3 pontos: a validação dos miRNAs conservados e não conservados em S. mansoni; a predição e a validação de seus potenciais genes alvos no genoma do parasito; e a análise da conservação evolutiva do cluster mir-71/2 em espécies de animais. Todos os resultados do trabalho mostrado acima fazem parte do manuscrito recentemente publicado na Revista Genomics: “Genome-wide identification of novel microRNAs and their target genes in the human parasite Schistosoma mansoni” (Anexo 2) (de Souza Gomes et al., 2011). 105

(135) Cluster Protostômio-específico mir-71/2 Capítulo V Cluster Protostômio-específico mir-71/2 106

(136) Cluster Protostômio-específico mir-71/2 V.1 Justificativa O desenvolvimento de ferramentas computacionais específicas para predição de miRNAs no genoma de diversas espécies tem sido realizado com sucesso. Os miRNAs tem sido encontrados formando clusteres em muitas espécies sendo estes processados através de um único transcrito (Saini et al., 2008). Em geral, miRNAs são considerados agrupados em forma de cluster quando estes se encontram menos de 10 kb distantes um do outro (Saini et al., 2007; Huang et al., 2011). No entanto, a distância correta para considerar miRNAs compondo um cluster é desconhecida, sendo permitidas distâncias um pouco maiores ou um pouco menores. Marco (2010) demonstrou que 50% dos miRNAs identificados em T. castelam se agrupam no genoma em uma distância inferior a 27 kb. Para esta classe de miRNAs tem sido sugerido uma co-evolução e uma provável ação conjunta nos genes alvos aumentando seu impacto no controle da expressão gênica (Altuvia et al., 2005; Chhabra et al., 2010). Diversas funções, relacionadas com o controle da expressão gênica, tem sido correlacionadas às moléculas de miRNAs. Um potencial alvo de estudo tem sido os miRNAs alocados em clusteres. Neste trabalho, foi desenvolvida uma ferramenta de busca, predição e análise de miRNAs alocados no cluster mir-71/2. Estas duas famílias de miRNAs, mir-2 e mir-71, tem mostrado características importantes e essenciais em diversos organismos. Os miRNAs da família mir-2 de D. melanogaster tem sido correlacionados a supressão da apoptose durante a embriogênese almejando o silenciamento de genes pró-apoptóticos, como K-box Notch da via Notch (Altuvia et al., 2005). O outro gene do cluster mir-71/2, mir-71, tem mostrado envolvimento na regulação de genes relacionados aos processos de longevidade, resistência ao estresse e danos ao DNA (de Lencastre et al., 2010). Têm sido mostrados a expressão de cel-mir-71 em estágios jovens do nematódeo e um decréscimo acentuado na fase de adultos atuando como modulador negativo da expressão de proteínas envolvidas com o ponto de checagem no ciclo celular como CDC-25.1 e PDK-1 (de Lencastre et al., 2010). Neste trabalho, o cluster mir-71/2 foi predito exclusivamente em genomas de organismos Protostômios sugerindo que este cluster mir-71/2 é Protostômio-específico. A ausência do cluster mir-71/2 em organismos de Deuterostômios e a presença em Protostômios merece ser investigada pois têm um potencial grande de estudo permitindo o desenho de 107

(137) Cluster Protostômio-específico mir-71/2 novas estratégias no combate de doenças causadas por Protostômios como nematóides e trematódeos. 108

(138) Cluster Protostômio-específico mir-71/2 V.2 Materiais e Métodos V.2.1 Identificação dos miRNAs e regiões genômicas Os precursores de miRNAs, referentes ao cluster mir-71/2, assim como suas estruturas maduras, foram obtidas no banco de dados miRBase (Welcome Trust Sanger Institute’s miRBase, http://microrna.sanger.ac.uk - release 17.0, maio de 2011). Para isso, foram utilizados a ferramenta miRBase Web Browser e as sequências disponibilizadas em formato fasta do próprio banco de dados. As prováveis posições dos miRNAs presentes nos clusteres foram apuradas empregando a ferramenta blastn (em parâmetros “default”) versus bancos de dados de genoma disponíveis de espécies do reino Animália. Os novos miRNAs identificados foram determinados a partir dos dados genômicos das seguintes espécies: Ixodes scapularis (VectorBase, http://www.vectorbase.org, IscalW1), Daphia pulex (Colbourne et al., 2011), Acyrthosiphon pisum (Human Genome Sequencing Center at the Baylor College of Medicine - http://www.hgsc.bcm.tmc.edu/) (The International Aphid Genomics Consortium, 2010), Anopheles gambiae (VectorBase, http://www.vectorbase.org, AgamP3.5), Rhodnius prolixus (VectorBase, http://www.vectorbase.org, RproC1, SuperContig.feb11), Pediculus humanus (VectorBase, http://www.vectorbase.org, PhumU1), Culex quinquefasciatus (VectorBase, http://www.vectorbase.org, CpipJ1), C. briggsae (WormBase database, http://www.wormbase.org/), S. mansoni (GeneDB, www.genedb.org) e S. japonicum (GeneDB, www.genedb.org). Os fragmentos de DNA genômico contendo os genes de miRNAs foram recuperados flanqueados, em cada lado, por 10000 nucleotídeos. Em geral, a distância de 10000 nucleotídeos, entre um miRNA e outro, tem sido considerada aceitável para considerá-los pertencentes ao mesmo cluster de miRNA. A atual versão do banco de dados de miRNA (miRBase – versão 17.0) tem considerado os miRNAs agrupados em clusteres aqueles encontrados no genoma em uma distância máxima de 10000 nucleotídeos, seja em fitas na mesma orientação ou orientações contrárias. Após a obtenção dos fragmentos genômicos de 10000 nt estes foram estocados no formato fasta para posterior análise. V.2.2 Predição computacional dos genes de miRNAs clusterizados Uma abordagem computacional, integrada com vários passos, foi utilizada para identificação de genes de miRNAs clusterizados. Esta busca foi realizada empregando 109

(139) Cluster Protostômio-específico mir-71/2 fragmentos genômicos específicos de espécies de animais tanto Protostômios quanto Deuterostômios. Brevemente, as sequências com potencial formação de estruturas similares a grampos (hairpin) foram identificadas usando o programa Einverted, do pacote EMBOSS, e a ferramenta BLASTn. Os parâmetros empregados para ferramenta Einverted foram: pontuação mínima (minimum score threshold) 20, penalidade de espaços (gap penalty) 4, pontuação de pareamento (match score) 2, pontuação de despareamento (mismatch score) -2 e permissão para extensão do fragmento repetitivo (maximum extent of repeats) 110. Tal estratégia foi capaz de obter sequências com tamanhos entre 50 e 110 nucleotídeos. Além disso, foi realizado BLASTn usando sequências de precursores de miRNAs para busca de possíveis sequências que se comportam na forma secundária, como grampos. Os parâmetros utilizados pela ferramenta BLASTn foram e-value menor que 0,001, tamanho mínimo de pareamento entre as sequências no alinhamento local 25 nucleotídeos e no mínimo 80% de identidade entre as sequências. As sequências positivas foram recuperadas das respectivas sequências genômicas considerando o número de nucleotídeos da sequência do miRNA precursor correspondente tanto a jusante quanto a montante. Foi também considerado a presença de sequências nas orientações da extremidade 5` para 3` quanto da extremidade 3` para 5`. As sequências recuperadas, com estruturas parecidas com grampos (“hairpin”) foram armazenadas em um arquivo tipo fasta e empregadas nas análises subsequentes. As sequências com prováveis estruturas de grampos foram, inicialmente, avaliadas quanto ao dobramento de sua estrutura secundária levando em consideração principalmente a energia livre mínima da molécula de RNA. Este procedimento foi realizado com o auxílio da ferramenta RNAfold proveniente do pacote de Vienna RNA Package(Hofacker, 2009). Os parâmetros aplicados para esta etapa foram energia livre mínima da estrutura secundária de RNA dobrada -20kcal/mol e opções "-p -d2 -noLP"(Hofacker, 2009). O valor de energia, -20 kcal/mol, em geral, tem sido considerado necessário para que uma molécula de precursor de miRNA seja estável propiciando a geração de miRNAs maduros. As estruturas positivas na etapa anterior foram filtradas em relação ao conteúdo de guanina e citosina (GC) na molécula. Foram mantidas as sequências com conteúdo de GC entre 30% e 65%. Posteriormente, os miRNAs maduros depositados no miRBase foram comparados com as sequências obtidas. Foi considerado um pareamento válido, entre as sequências obtidas (estrutura provável do precursor de miRNAs) e os miRNAs maduros depositados no miRBase, aqueles, no qual, o alinhamento gerado, gerou um duplex híbrido com no máximo 6 despareamentos de base (mismatches) no total e apenas 1 despareamento na região seed (entre os nucleotídeos 2 e 8 da sequência do miRNA maduro). Com o intuito de manter 110

(140) Cluster Protostômio-específico mir-71/2 apenas as estruturas de RNA relacionadas com os miRNAs, as sequências com alta similaridade com os RNA não codificadores, rRNA, snRNA, SL RNA, SRP, tRNAs e RNase P, foram removidas. Foi utilizado Rfam MicroRNA Registry(version 3.0) para conduzir este procedimento. Após a execução destes filtros os miRNAs, tanto na forma madura, quanto na forma precursora, foram armazenados em arquivo multifasta para posterior análise. V.2.3 Análise Comparativa dos miRNAs clusterizados em mir71/2 Um conjunto de parâmetros foi selecionado e empregado para comparar características de conhecidos miRNAs depositados no miRBase versão 17.0 presentes no cluster mir-71/2 e aqueles preditos neste trabalho. Foram recuperados as sequências maduras e precursoras de cada miRNA conhecido e separados em diferentes arquivos fasta. As seguintes características foram utilizadas para comparação: energia mínima livre ajustada (AMFE), índice de energia mínima livre (MFEI), conteúdo de GC (GC), energia mínima livre do conjunto termodinâmico (MFEE), diversidade do conjunto termodinâmico e freqüência da estrutura de energia mínima livre no conjunto termodinâmico. O parâmetro AMFE foi medido utilizando o MFE encontrado para 100 nucleotídeos em tamanho. O parâmetro AMFE foi calculado seguindo a seguinte formula: MFEI = [(AMFE) × 100] / (G% + C%)](Zhang et al., 2006a). As medidas de diversidade do conjunto termodinâmico, freqüência da estrutura de energia mínima livre no conjunto termodinâmico e MFE foram obtidas usando RNAfold. Estas características foram agrupadas e analisadas na forma de gráficos e tabelas. V.2.4 Conservação evolutiva e Distribuição Filogenética dos miRNAs clusterizados em mir71/2 As sequências de nucleotídeos dos precursores de miRNAs (pré-miRNAs), depositadas no miRBase e identificadas neste trabalho, foram alinhadas utilizando o programa ClustalX 2.0(Thompson et al., 2002; Larkin et al., 2007). Os parâmetros de alinhamento utilizados foram: abertura de espaços entre os alinhamentos de sequências 22.50 (“gap opening”) e extensão de espaços entre os pedaços de sequências alinhadas 0,83 (“gap extension”). Em seguida, os programas RNAfold e RNAalifold, provenientes do pacote Vienna RNA, foram empregados para verificação da estrutura secundária dos preditos precursores de miRNAs e para verificação da correlação entre o alinhamento múltiplo de 111

(141) Cluster Protostômio-específico mir-71/2 sequência dos precursores de miRNAs e a estrutura secundaria predita para cada um deles(Hofacker, 2009). As sequências maduras dos miRNAs foram comparadas utilizando WebLogo 2.8.2 (http://weblogo.berkeley.edu/logo.cgi) (Crooks et al., 2004). Foi considerada no desenho do gráfico a contribuição de cada nucleotídeo para cada posição na estrutura primaria dos miRNAs maduros. Alem disso realizou-se uma análise filogenética dos precursores de miRNAs preditos e seus homólogos. Esta foi realizada utilizando o método Neighbor-joining aplicando como modelo Kimura dois parâmetros (“Kimura-two parameters”) para estimar a divergência entre as sequências(Saitou and Nei, 1987). Tanto o método quanto o modelo foram aplicados utilizando a ferramenta MEGA 4 (Tamura et al., 2007). A confiabilidade estatística de cada ramo na árvore gerada foi avaliada utilizando “bootstrap” com 2000 réplicas. Os valores de “bootstrap” maiores que 30 foram mantidos entre os nós de cada ramo. Para melhor visualização nós indicamos o agrupamento de sequências baseados na filogenia da árvore evolutiva consenso. As abreviações para cada organismo nas árvores filogenéticas são mostradas a seguir: ame (Apis mellifera), api (Acyrthosiphon pisum), bfl (Branchiostoma floridae), bma (Brugia malayi), bmo (Bombyx mori), cbr (Caenorhabditis briggsae), cel (Caenorhabditis elegans), cqu (Culex quinquefasciatus), crm (Caenorhabditis remanei), cte (Capitella teleta), dan (Drosophila ananassae), der (Drosophila erecta), dgr (Drosophila grimshawi), dme (Drosophila melanogaster), dmo (Drosophila mojavensis), dpe (Drosophila persimilis), dps (Drosophila pseudoobscura), dpu (Daphnia pulex), dre (Danio rerio), dse (Drosophila sechellia), dsi (Drosophila simulans), dvi (Drosophila virilis), dwi (Drosophila willistoni), dya (Drosophila yakuba), isc (Ixodes scapularis), lgi (Lottia gigantea), lmi (Locusta migratoria), nlo (Nasonia longicornis), nvi (Nasonia vitripennis), sja (Schistosoma japonicum), sko (Saccoglossus kowalevskii), sla (Saguinus labiatus), sma (Schistosoma mansoni), sme (Schmidtea mediterranea), spu (Strongylocentrotus purpuratus) e tca (Tribolium castaneum). V.2.5 Implementação e plotagem dos gráficos A instalação, implementação e execução das ferramentas computacionais, bem como dos scripts, foram realizadas na Plataforma GNU Linux (Ubuntu). A linguagem de programação utilizada para escrita dos script foi PERL, que se comportou mais simples para o trabalho com arquivos texto de genoma. A plotagem dos gráficos boxplots foi executada utilizando o programa R 2.12.1 (“The R Project for Statistical Computing” - http://www.rproject.org/). 112

(142) Cluster Protostômio-específico mir-71/2 V.3 Resultados e Discussão V.3.1 Predição do cluster mir-71/2 Neste trabalho, uma ferramenta computacional integrada foi desenvolvida para predição e identificação de miRNAs alocados no cluster miR71/2. Esta ferramenta foi aplicada em diferentes genomas de espécies de Protostômios e Deuterostômios, considerando miRNAs no mesmo cluster distantes até 10 kb um do outro. O cluster de miRNA mir71/2 tem sido composto pelos miRNAs da família miR-2 (miRBase MIPF0000049) e os miRNAs da família mir-71 (miRBase MIPF0000278). A família mir-2 possui como membros mir-2 e mir-13, os quais têm sido considerados na mesma família devido à alta similaridade de sequência principalmente na região seed. Marco (2010) tem mostrado a presença deste cluster de miRNAs em espécies de insetos (Protostômios Artrópodes) e alguns de invertebrados(Marco et al., 2010). Este cluster tem sido mostrado também em organismos do clado Lophotrochozoa Platelmintos como S. mansoni, S. japonicum, S. mediterranea e Echinococcus granulosus (Palakodeti et al., 2006; Huang et al., 2009; Hao et al., 2010; Cucher et al., 2011; de Souza Gomes et al., 2011). Nosso grupo de trabalho identificou a presença deste cluster em S. mansoni utilizado o algoritmo mostrado no capítulo IV (Figura 35). No entanto, o algoritmo apresentado neste capítulo é específico de regiões contendo o cluster mir-71/2 e foi capaz de predizer além dos miRNAs identificados anteriormente no Capítulo IV, um novo miRNA, sma-mir-2f, compondo o cluster sma-mir-71/2a/2e/2f (Figura 35). A identificação de miRNAs do cluster mir-71/2 foi esgotada utilizando as últimas versões dos genomas de espécies de Lophotrochozoans e Ecdysozoans. Em alguns casos as sequências não representavam o genoma completamente fechado, como é o caso de S. mansoni. Assim, uma análise deve ser realizada ao final do fechamento completo do genoma, para evitar a subestimação do número de miRNAs compondo o cluster mir-71/2. V.3.2 Cluster mir-71/2 Protostômio específico No intuito de investigar a co-evolução e a presença do cluster mir-71/2 apenas em espécies Protostômios, (avaliando todo Reino Animália incluindo Protostômios e Deuterostômios) sequências genômicas nas vizinhanças dos genes das famílias de miRNAs, mir-2 e mir-71, foram recuperadas dos bancos de dados das espécies I. scapularis, D. pulex, 113

(143) Cluster Protostômio-específico mir-71/2 A. pisum, A. gambiae, R. prolixus, P. humanus, C. quinquefasciatus, C. briggsae, S. mansoni, S. japonicum, B. floridae, S. kowalevskii, S. purpuratus, A. aegypti, D. melanogaster, C. elegans, C. briggasae, L. gigantea, C. teleta e S. mediterranea. A presença ou ausência do cluster foi determinada observando a disposição das sequências dos miRNAs, miR-2, mir-13 e mir-71 na sequência genômica. Foi considerado como cluster mir-71/2 conservado todo trecho de sequência genômica contendo no mínimo um membro da família mir-2 e um membro da família mir-71, em uma distância inferior a 10 kb. Os resultados mostraram a presença do cluster mir-71/2 apenas em espécies de Protostômios (Ecdysozoans e Lophotrochozoans) (Figura 36). Foram identificados 28 novos precursores de miRNAs e 28 novos miRNAs maduros, sendo todos não depositados no banco de dados de miRNA, miRBase, versão 17.0 (miRBase – http://www.mirbase.org). Nesta versão do miRBase, aproximadamente 180 miRNAs tem sido depositados como representantes da família mir-2 ou da família mir-71. O número de novos miRNAs encontrados, neste trabalho, representa mais do que 15 % do total de genes destas famílias sendo um número consideravelmente expressivo para novas predições de miRNAs. Os novos miRNAs preditos foram nomeados de acordo com o respectivo ortólogo (Tabela 10). Foram preditos vinte miR-2 e quatro mir71dentro do clado Lophotrochozoa e Ecdysozoa e quatro mir-13 dentro do clado Ecdysozoa. Em geral, os novos miRNAs identificados mostraram alta conservação ao nível de nucleotídeos quando comparados com seus ortólogos. Os resultados encontrados neste trabalho, foram comparados com os dados obtidos utilizando a ferramenta MapMi (http://www.ebi.ac.uk/enright-srv/MapMi/). A comparação foi possível utilizando genomas utilizados pelos dois algoritmos concomitantemente, sendo a espécie R. prolixus excluída desta análise. Dentre os 23 miRNAs identificados por este algoritmo, apenas 15 miRNAs foram co-identificados pelo programa MapMi. As análises de comparação utilizaram os dados pré-computados fornecidos pelo algoritmo MapMi com parâmetros default. Como pode ser observado o algoritmo utilizado neste trabalho foi mais eficiente para identificação de miRNAs presentes específicamente no cluster mir-71/2 quando comparado com o programa MapMi. A especificidade do algoritmo para predição de genes compondo este cluster é uma vantagem do uso deste algoritmo já que o programa MapMi prediz não apenas pré-miRNA provenientes do cluster miR-71/2, mas todos os miRNAs prováveis presentes no genoma estudado. Esta mesma análise comparativa foi realizada utilizando o programa disponível miROrtho (http://cegg.unige.ch/mirortho/browse). Foi também possível apenas a comparação das sequências genômicas provenientes das espécies utilizadas em ambos os algoritmos como 114

(144) Cluster Protostômio-específico mir-71/2 A. gambiae, P. humanus e D. pulex. Entre dez miRNAs identificados nestas espécies apenas 3 foram identificados utilizando miROrtho. Os miRNAs identificados exclusivamente neste trabalho foram: rho-mir-2a-2, rhomir-2a-1, rho-mir-2b-1, rho-mir-2a-3, sja-mir-2f, sma-mir-2f, dpu-mir-2b-1, rho-mir-71, iscmir-13a, dpu-mir-13b, api-mir-13b e phu-mir-13b. Estes resultados sugerem que a utilização de ferramentas mais específicas para busca de miRNAs pode ser uma alternativa mais adequada para identificação de novos e conservados miRNAs compondo clusteres de miRNA em espécies de animais. A distribuição dos miRNAs alocados no cluster 71/2 na escala evolutiva foi também avaliada neste trabalho. A figura 36 apresenta o momento no qual o cluster mir-71/2 provavelmente surgiu na evolução das espécies. Este momento tem sido proposto ser logo após a explosão Cambriana com o aparecimento dos primeiros Eumetazoans, associado ao fato dos miRNAs, deste cluster, estarem ausentes em Cnidarians, Parazoans ou espécies de outros Reinos como Plantae ou Fungi (Figura 36). Estes resultados levantam a hipótese que o cluster mir-71/2 é Prototômio-específico. Esta hipótese é corroborada pois nas espécies B. floridae, S. purpuratus e S. kowalevskii o membro da família de miRNAs mir-2 (mir-2 ou mir-13) não foi localizado nem próximo do miRNA mir-71, compondo o cluster, nem em qualquer outra parte do genoma (Figura 36). Novos miRNAs das famílias mir-2 e mir-71 foram preditos nos genomas das espécies Ecdysozoans e Lophotrochozoans. A representação por setas na figura 36 mostra a presença do miRNA no cluster mir-71/2. O único gênero dentro deste clado que não apresentou esta estrutura de cluster foi o gênero Drosophila. Este gênero tem apresentado diferentes clusteres como mir2/2 e mir-2/13 sem a presença de mir-71 (miRBase). Os resultados deste trabalho corroboram com os resultados obtidos por Marco (2010) que sugerem a fragmentação deste cluster no gênero Drosophila com a perda do mir-71 durante a evolução. O miRNA mir-71 foi encontrado em espécies de Deuterostômios Echinodermatas, Hemichordatas, e Cephalochordatas mas não encontrado em Deuterostômios Vertebratas e Urochordatas (Figura 36). Foi observado que os Deuterostômios Vertebratas e Urochordatas não apresentaram nenhum dos representantes do cluster mir-71/2 no genoma. A ausência ou presença do cluster ou apenas de um dos membros do cluster no genoma pode ter um impacto direto nos genes alvos e conseqüentemente no controle da expressão gênica no organismo. Como observado na figura 36, a perda deste cluster durante a evolução pode ter implicado em uma mudança no repertório de genes regulados pelos miRNAs nos organismos. 115

(145) Cluster Protostômio-específico mir-71/2 Tabela 10: Sequências preditas dos miRNAs maduros, miRNA mir-2, mir-13 and mir-71, seus respectivos ortólogos no miRBase e suas predições pelos programas MapMi e Mirortho. miRNA mir-2 aga-mir-2 rho-mir-2a-2 rho-mir-2a-1 rho-mir-2b-1 rho-mir-2a-3 phu-mir-2c phu-mir-2 phu-mir-2a-2 phu-mir-2a-1 cqu-mir-2c cqu-mir-2b sja-mir-2f sma-mir-2f sma-mir-2d sma-mir-2c sma-mir-2a sma-mir-2b sma-mir-2e cbr-mir-2 dpu-mir-2b-1 mir-71 rho-mir-71 sma-mir-71b aga-mir-71 phu-mir-71 mir-13 isc-mir-13a dpu-mir-13b api-mir-13b phu-mir-13b miRNA maduro Região Seed Tamanho Ortólogo miRBase (SSearch) UAUCACAGCCAGCUUUGAAGAGC UAUCACAGCCAGCUUUGAUGAGC UAUCACAGCCACUUUGAUGAGC UAUCACAGCCAUUUUUGACGAGU UAUCACAGCCAGCUUUGAUGGGC UAUCACAGCCAGCUUUGAUGAGC UAUCACAGCCAGCUUUGAUGAGCG UAUCACAGCCAGCUUUGAUGAGUG UAUCACAGCCACUUUGAUGACC UAUCACAGCCAGCUUUGAUGAGC UAUCACAGCCAGCUUUGAUGAGCU UCACAGCCAAUAUUGAUACC UCACAGCCAAUAUUGAUACC UAUCACAGUCCUGCUUAGGUGA UAUCACAGCCGUGCUUAAGGGC UCACAGCCAGUAUUGAUGAACG UAUCACAGCCCUGCUUGGGACACA UAUCACAGUCCAAGCUUUGGU UAUCACAGCCAGCUUUGAUGUGC UAUCACAGCCAGCUUUGACGAGC 23 23 22 23 23 23 24 24 22 23 24 20 20 22 22 22 24 21 23 23 cqu-mir-2 bma-mir-2a dan-mir-2a-1 aae-mir-2b dpu-mir-2a tca-mir-2c ame-mir-2-1 dwi-mir-2a-1 dps-mir-2a-1 aae-mir-2c aae-mir-2b sja-mir-2a egr-mir-2c sja-mir-2d sja-mir-2c sja-mir-2a sja-mir-2b sja-mir-2e crm-mir-2 dme-mir-2b-1 Predito Predito Predito Predito Predito Predito Predito Predito Predito Predito Predito Predito - Predito Predito Predito - UGAAAGACAUGGGUAGUGAGAUG UGAAAGACUUGAGUAGUGAGACG AGAAAGACAUGGGUAGUGAGAUA UGAAAGACAUGGGUAGUGAGAUG 23 23 23 23 nvi-mir-71 sja-mir-71b cqu-mir-71 bmo-mir-71 Predito Predito Predito - UAUCACAGCCAUCUUUGAUGACC UAUCACAGCCAUUCUAGAUGCGC UAUCACAGCCGUUUUUGACAAUU UAUCACAGCCAUAUUUGACAAGU 23 23 23 23 ngi-mir-13a ame-mir-13b ame-mir-13b nvi-mir-13b - - 116 Identificação MapMi Identificação Mirortho

(146) Cluster Protostômio-específico mir-71/2 Os miR-71 foram encontrados em regiões intergênicas dos Deuterostômios B. floridae, S. purpuratus e S. kowalevskii. Este resultado corrobora com a posição destes miRNAs em espécies de Protostômios que apresentaram, em geral, este miRNA localizado em regiões intergênicas. Entretanto em B. floridae o bfl-miR-71 forma cluster com o miRNA “bfl-mir-4890” é espécie-específico (Figura 36). A presença de um miRNA espécieespecífico próximo de mir-71, compondo um cluster, tem sido encontrado também em espécies de Prototômios como em C. teleta e S. mediterranea (Figura 36). Uma exceção, neste trabalho, foi a predição de um cluster com tamanho superior a 10kb. O miRNA cbr-mir-2, predito no genoma de C. brigassea, foi encontrado em uma distância de 11 Kb do miRNA cbr-mir-71. No entanto, este miRNA foi considerado nas análises deste trabalho devido sua alta conservação ao nível de nucleotídeos quando comparado com o miRNA cel-mir-2, identificado no genoma de C. elegans (mirBase) (Figura 37). As sequências maduras do novo miRNA predito e do ortólogo cel-mir-2, apresentaram 100% de identidade ao nível de nucleotídeos (Figura 37). Esta identidade mostra a conservação destas estruturas de clusteres, evidenciando uma conservação não apenas ao nível de genoma, mas também ao nível dos potenciais alvos destes miRNAs, influenciando a dinâmica biológica nas células dos respectivos organismos. 117

(147) Cluster Protostômio-específico mir-71/2 118

(148) Cluster Protostômio-específico mir-71/2 Figura 36:Árvore evolutiva e representação dos genes mir-71, mir-2 e mir-13. A árvore representa um esquema dos genes de miRNAs mir71, mir-2 e mir-13 na escala evolutiva. A disposição destes genes em diversas espécies é representada por barras horizontais com seta indicando a presença do gene. A legenda mostra as formas dispostas na figura e suas denominações. A disposição dos ramos da árvore foi extraída de Hashimoto-Gotoh, 2009. Figura 37: Análise conservativa das estruturas dos genes cbr-mir-2 e cel-mir-2. A estrutura secundária dos genes é mostrada pelos sinais, “(“, “)”, “.”, acima do alinhamento global. A estrutura do miRNA maduro conservada é mostrada pelo retângulo pontilhado preto. A região seed do miRNA maduro é mostrada na parte inferior da figura. 119

(149) Cluster Protostômio-específico mir-71/2 V.3.3 Duplicação do cluster mir-71/2 O número de clusteres, mir-71/2, encontrados em espécies Lophotrochozoans, foi diferente do encontrado em espécies Ecdysozoans. Este cluster foi encontrado duplicado e com alto nível de identidade nos Platelmintos (Lophotrochozoans) S. mansoni, S. japonicum e S. mediterranea (Huang et al., 2009; de Souza Gomes et al., 2011). Por outro lado, a predição dos alvos de mir-71 e mir-2 sugerem que os miRNAs parálogos distribuídos no genoma de Platelmintos podem promover o silenciamento de diferentes alvos implicando em uma regulação bem específica. Um exemplo, ocorre com os genes sma-mir-71 e sma-mir-71b em S. mansoni. Os resultados dos alvos destes genes gerados neste trabalho (Capítulo VI) mostram como o repertório de alvos regulados por miRNAs parálogos podem ser diferentes. O cluster sma-mir-71/2, localizado no cromossomo W, sugere uma regulação gênica sexo específica uma vez que este cluster está presente apenas em um cromossomo presente apenas em fêmea regulando provavelmente genes alvos envolvidos com a diferenciação sexual, maturação sexual e oviposição (Figura 35). Do ponto de vista biológico, estes miRNAs sexoespecíficoss, futuramente, podem servir como ferramentas importantes para o entendimento da patologia da esquistossomose no hospedeiro definitivo. V.3.4 Caracterização dos pré-miRNAs Neste trabalho, utilizando a ferramenta RNAfold, foi realizada a caracterização da estrutura secundária dos novos precursores de miRNAs, com a finalidade de observar cada dobramento, evitando falsos positivos (Figura 38). Todos os 28 precursores de miRNAs apresentaram uma estrutura secundária semelhante aos respectivos ortólogos. As estruturas em formato de grampos (hairpin) foram observadas em todos os miRNAs preditos. Estas estruturas são características de precursores de miRNAs uma vez que todos os miRNAs validados possuem este tipo de estrutura. Além disso, a posição dos miRNAs maduros na sequência precursora também corroborou com o posicionamento dos ortólogos, ou na parte 3p ou 5p do precursor(Figura 38). As estruturas secundárias de cada predito (pré-miR-71, pré-miR-13 e pré-miR-2) mostraram, além de uma estrutura conservada, uma alta estabilidade representada pela energia mínima livre (MFE) grande e negativa (Tabela 11). 120

(150) Cluster Protostômio-específico mir-71/2 Figura 38: Estruturas secundárias dos precursores de miRNAs Protostômios-específicos mir-71, mir-2, mir-13. O programa RNAFold do pacote Vienna foi utilizado para elucidação da provável estrutura secundária. Os miRNAs maduros são evidenciados por uma caixa cinza. 121

(151) Cluster Protostômio-específico mir-71/2 Tabela 11: Características estruturais e termodinâmicas dos novos precursores Protostômio-específicos. mirNA G (%) A (%) C (%) U (%) Conteúdo AU Taxa UA Taxa GC Conteúdo GC Tamanho MFE (kcal/mol) AMFE (kcal/mol) MFEI MFEE (kcal/mol) Frequencia (%) Diversidade mir-2 aga-mir-2 24,77 21,10 23,85 30,28 51,38 1,43 1,04 48,62 109 -51,96 -47,67 -0,98 -48 1,05% 12,97 rho-mir-2a-2 22,43 28,97 18,69 29,91 58,88 1,03 1,20 41,12 107 -48,4 -45,23 -1,10 -48,4 2,16% 6,19 rho-mir-2a-1 23,40 26,60 15,96 34,04 60,64 1,28 1,47 39,36 94 -42,4 -45,11 -1,15 -42,4 23,65% 2,25 rho-mir-2b-1 18,39 27,59 20,69 33,33 60,92 1,21 0,89 39,08 87 -38,89 -44,70 -1,14 -38,89 6,45% 6 rho-mir-2a-3 21,05 27,37 21,05 30,53 57,89 1,12 1,00 42,11 95 -33 -34,74 -0,83 -32,35 2,38% 15,44 phu-mir-2c 17,78 34,44 15,56 32,22 66,67 0,94 1,14 33,33 90 -31,62 -35,13 -1,05 -31,62 54,63% 1,38 phu-mir-2 28,36 23,88 22,39 25,37 49,25 1,06 1,27 50,75 67 -30,2 -45,07 -0,89 -30,2 51,94% 2,42 phu-mir-2a-2 20,91 20,91 17,27 40,91 61,82 1,96 1,21 38,18 110 -37,6 -34,18 -0,90 -35 2,93% 10,98 phu-mir-2a-1 26,14 25,00 19,32 29,55 54,55 1,18 1,35 45,45 88 -40,1 -45,57 -1,00 -40,1 22,16% 7 cqu-mir-2c 21,21 25,25 25,25 28,28 53,54 1,12 0,84 46,46 99 -36,43 -36,80 -0,79 -36,43 35,96% 2,29 cqu-mir-2b 24,47 25,53 22,34 27,66 53,19 1,08 1,10 46,81 94 -36,1 -38,40 -0,82 -33,07 1,67% 13,77 sja-mir-2f 27,36 20,75 19,81 32,08 52,83 1,55 1,38 47,17 106 -42,6 -40,19 -0,85 -43,6 1,55% 8,04 sma-mir-2f 25,89 25,00 20,54 28,57 53,57 1,14 1,26 46,43 112 -41,8 -37,32 -0,80 -40,7 6,03% 9,92 sma-mir-2d 20,00 27,62 19,05 33,33 60,95 1,21 1,05 39,05 105 -41 -39,05 -1,00 -41 24,04% 4,96 sma-mir-2c 23,66 23,66 23,66 29,03 52,69 1,23 1,00 47,31 93 -34,22 -36,80 -0,78 -34,22 20,00% 5,15 sma-mir-2a 25,93 24,69 20,99 28,40 53,09 1,15 1,24 46,91 81,00 -39,4 -48,64 -1,04 -39,40 50,64% 1,77 sma-mir-2b 25,88 22,35 28,24 23,53 45,88 1,05 0,92 54,12 85,00 -41,7 -49,06 -0,91 -41,50 37,87% 3,44 sma-mir-2e 16,67 23,61 20,83 38,89 62,50 1,65 0,80 37,50 72,00 -25 -34,72 -0,93 -24,40 53,04% 2,03 cbr-mir-2 24,11 24,11 18,75 33,04 57,14 1,37 1,29 42,86 112 -39,01 -34,83 -0,81 -37,8 2,13% 14,49 dpu-mir-2b-1 26,13 27,03 24,32 22,52 49,55 0,83 1,07 50,45 111 -41,8 -37,66 -0,75 -40,8 12,90% 5,77 mir-71 rho-mir-71 25,64 24,36 21,79 28,21 52,56 1,16 1,18 47,44 78 -44,46 -57,00 -1,20 -44,46 33,01% 2,89 sma-mir-71b 24,11 16,07 28,57 31,25 47,32 1,94 0,84 52,68 112 -35 -31,25 -0,59 -28,74 1,87% 13,25 aga-mir-71 28,18 21,82 20,00 30,00 51,82 1,38 1,41 48,18 110 -48 -43,64 -0,91 -40,91 3,59% 17,64 phu-mir-71 20,83 22,92 17,71 38,54 61,46 1,68 1,18 38,54 96 -38,46 -40,06 -1,04 -35,31 6,77% 7,91 mir-13 isc-mir-13a 22,22 22,22 27,78 27,78 50,00 1,25 0,80 50,00 90 -36,3 -40,33 -0,81 -36,3 40,41% 3,1 dpu-mir-13 27,50 18,75 23,75 30,00 48,75 1,60 1,16 51,25 80 -38,3 -47,88 -0,93 -38,3 38,53% 2,02 api-mir-13b 23,53 27,06 16,47 32,94 60,00 1,22 1,43 40,00 85 -29,7 -34,94 -0,87 -29,24 7,30% 8,9 phu-mir-13b 19,75 24,69 18,52 37,04 61,73 1,50 1,07 38,27 81 -27,5 -33,95 -0,89 -26,9 13,12% 6,5 MFE: Energia mínima livre; AMFE: Energia mínima livre Ajustada; MFEI: Índice de Energia mínima livre; MFEE: Energia mínima livre do conjunto 122

(152) Cluster Protostômio-específico mir-71/2 A versão 17.0 do mirBAse tem depositado 146 pré-miRNAs pertencentes a família mir-2, sendo 96 mir-2 e 50 mir-13. A família mir-71, representada apenas por mir-71, possui 27 precursores depositados no miRBase. Uma análise comparativa das características dos miRNAs depositados no miRBase e dos miRNAs identificados neste trabalho, mostrou uma alta correlação ao nível termodinâmico e estrutural, utilizando as seguintes características: conteúdo de GC, conteúdo de AU, porcentagem de A, C, G e U, razão UA, razão GC, MFE, MFEE, AMFE, MFEI, diversidade do conjunto termodinâmico e frequência do conjunto termodinâmico. Os valores obtidos para cada característica do predito miRNA foram demonstrados na tabela 11. A distribuição dos valores de todas as características dos novos miRNAs identificados foram incluídos nos gráficos obtidos a partir dos valores de conhecidos miRNAs depositados no miRBase (Figuras 39 e Anexo 1). Em geral, a distribuição dos valores referentes às características dos novos precursores de miRNA mostrou-se semelhante a distribuição dos miRNAs conhecidos. A maioria foi encontrada entre o primeiro e terceiro quartil dos gráficos, ou seja, próximo da mediana dos dados conhecidos. Por exemplo, o conteúdo de GC dos precursores de miRNA preditos mostrou entre 35% e 55%, corroborando com os valores encontrados em conhecidos miRNAs deste cluster. Além disso, a energia mínima livre destas moléculas mostrou valores muito similares aos valores de miRNAs conhecidos. Valores abaixo de -20 ou -25 kcal/mol tem sido considerados adequados para predição de estruturas secundárias de miRNAs. Estes valores geram moléculas mais estáveis aumentando a probabilidade de se predizer miRNAs reais. Os valores das estruturas secundárias referentes aos novos miRNAs se mostraram bem estáveis, com valores entre -20 kcal/mol e -50 kcal/mol. A tabela 11 mostra todos os valores individuais. Como observado as características do miRNAs identificados se mostraram bem semelhantes comparadas aos ortólogos, confirmando a conservação do gene ao nível estrutural e termodinâmico e mantendo sua provável função no organismo. 123

(153) Cluster Protostômio-específico mir-71/2 A B Figura 39: Distribuição dos valores relacionados às características (A) Conteúdo de GC e (B) MFE dos novos precursores de miRNAs. Os valores utilizados na confecção dos gráficos foram baseados em precursores de miRNAs depositados no banco de dados miRBase. Os nomes dos novos miRNA estão representados em cada gráfico do grupo de miRNA correspondente. As caixas representam 50% dos dados analisados. A extremidade mais baixa representa o primeiro quartil ou 25 % dos dados e a extremidade mais alta 124

(154) Cluster Protostômio-específico mir-71/2 representa o terceiro quartil ou 75 % dos dados. A linha horizontal dentro da caixa representa a mediana e os valores maiores que 1,5 vezes a mediana são os “outliers”. V.3.5 Análise Filogenética e Comparativa dos novos miRNAs Neste trabalho, foram realizadas análises filogenéticas dos membros do cluster mir71/2, mir-13 e mir-71, no intuito de observar e confirmar a distribuição evolutiva dos novos miRNAs identificados e seus ortólogos. As análises foram realizadas utilizando tanto os miRNAs conhecidos quanto os novos. Como matriz e modelo de distribuição filogenética foram utilizados matriz Neighbor-joining e o modelo Kimmura-2-parâmetros. Empregando este método, os miRNAs mir-13 se mostraram distribuídos em dois clados principais: mir13/mir-13b e mir-13a. Os novos miRNAs agruparam nos clados dos respectivos ortólogos como mostra a Figura 40. Por exemplo, o novo miRNA isc-mir-13a, predito a partir do genoma da espécie I. scapularis, agrupou juntamente com os conhecidos ortólogos miR-13a de espécies de Artrópodes. Já os miRNAs api-mir-13b, phu-mir-13b e dpu-mir-13b agruparam-se no outro clado mir-13/mir-13b juntamente com genes mir-13 e mir-13b provenientes de espécies de Protostômios (Figura 40). As análises comparativas dos novos genes preditos mir-13 foram realizadas utilizando ClustalX 2.0, com parâmetros modificados, e RNAalifold para verificar a conservação da estrutura secundária no alinhamento global (Figura 41). O alinhamento múltiplo de sequência mostrou grande conservação dos miRNAs identificados com seus ortólogos principalmente na região onde se encontra o miRNA maduro (Figura 41). A região seed do miRNA maduro apresentou 100% de identidade comparando todos miRNAs. Esta característica conservativa do miRNA maduro aponta uma importância essencial desta molécula para a atuação no controle da expressão gênica, já que os alvos são dependentes do pareamento principalmente da região seed do miRNA maduro. 125

(155) Cluster Protostômio-específico mir-71/2 Figura 40: Distribuição evolutiva dos novos mir-13 no grupo Protostômios. As relações filogenéticas foram referidas entre os novos precursores de mir-13 e seus homólogos. A árvore filogenética foi gerada utilizando como método Neighbor-Joining, como modelo Kimura-2-parâmetros e executada no programa MEGA 4.0. Os clados distintos apresentaram os grupos mir-13a e mir-13/13b. Somente “bootstrap” acima de 30 foram considerados para 2000 réplicas analisadas. 126

(156) Cluster Protostômio-específico mir-71/2 Figura 41: Conservação dos novos mir-13 no grupo Protostômios O alinhamento múltiplo de sequência entre os precursores de mir-13 e seus respectivos ortólogos de Ecdysozoa e Lophotrochozoa foram realizadas usando ClustalX 2.0 e RNAalifold. As formas maduras dos miRNAs são mostradas nas caixas cinza. A análise filogenética e comparativa dos novos precursores de miRNA, aga-mir-71, phu-mir-71, sma-mir-71b e rho-mir-71 foram realizadas utilizando os mesmos programas e parâmetros citados acima para os mir-13. A figura 42 mostra a conservação dos miRNAs mir-71 incluindo os identificados neste trabalho. A região relacionada ao miRNA maduro se mostrou altamente conservada apresentando no alinhamento global 100% de identidade na região seed. A análise filogenética dos representantes desta família de miRNA mostrou os preditos miRNAs phu-mir-71, rho-mir-71 e aga-mir-71 agrupados no clado Ecdysozoa juntamente como os respectivos ortólogos. Corroborando com os resultados anteriores (capitulo IV) o miRNA sma-mir-71b agrupou juntamente com o ortólogo sja-mir71b formando um clado Platelminto específico. 127

(157) Cluster Protostômio-específico mir-71/2 A B Figura 42: Conservação dos novos mir-71 no grupo Protostômios (a) As relações filogenéticas foram referidas entre os novos mir-71 e seus ortólogos. A árvore filogenética foi 128

(158) Cluster Protostômio-específico mir-71/2 gerada utilizando como método Neighbor-Joining, como modelo Kimura-2-parâmetros e executada no programa MEGA 4.0. Os clados distintos apresentaram os grupos Deuterostômios, Ecdysozoa e Lophotrochozoa. Somente “bootstraps” acima de 30 foram considerados para 2000 replicas analisadas (b) O alinhamento múltiplo de sequência entre os precursores de mir-71 e seus respectivos ortólogos de Ecdysozoans e Lophotrochozoans foram realizadas usando ClustalX 2.0 e RNAalifold. As formas maduras dos miRNAs são mostradas nas caixas cinza. V.3.6 Conservação dos miRNAs maduros do cluster mir-71/2 As sequências dos novos miRNAs maduros, miR-2, miR-71 and miR-13, identificadas neste trabalho, foram obtidas baseadas nas posições dos respectivos ortólogos nas sequências precursoras. Além disso, as sequências maduros dos miRNAs ortólogos referentes a cada família de miRNAs foram recuperadas, a fim de compará-las com o conjunto de maduros identificados neste trabalho. As sequências dos miRNAs ,mir-13 e mir2, apresentaram alta similaridade ao nível de nucleotídeos justificando o agrupamento de ambos na mesma família. No entanto, as sequências maduras e precursoras destes genes apresentaram particularidades permitindo a separação destas sequências nas respectivas subfamílias mir-2 e mir-13. A figura 43 e 44 mostra a distribuição dos nucleotídeos provenientes dos conhecidos miRNAs maduros mir-2 e mir-13 obtidos do respectivo precursor de miRNA. A representação Weblogo mostra a freqüência de cada nucleotídeo (U, A, C ou G) para cada específica posição na sequência madura do miRNA. Os nucleotídeos representados com letras maiores mostram uma maior contribuição para aquela determinada posição na sequência madura. Por outro lado, tamanhos menores representam menor contribuição na posição específica. A presença específica de um determinado nucleotídeo na sequência madura do miRNA, principalmente entre os nucleotídeos 2 e 8, esta diretamente relacionada com o conjunto de RNAs mensageiros almejados por aquela molécula mostrando assim a importância da caracterização desta região. 129

(159) Cluster Protostômio-específico mir-71/2 Figura 43: miRNAs maduros da família mir-2. Representação Weblogo das sequências maduras dos miRNAs mir-2 e as sequências maduras dos novos miRNAs identificados. A caixa cinza corresponde a região seed dos miRNAs maduros entre os nucleotídeos 2 e 8. Figura 44: miRNAs maduros da família mir-13. Representação Weblogo das sequências maduras dos miRNAs mir-13 e as sequências maduras dos novos miRNAs identificados. A caixa cinza corresponde a região seed dos miRNAs maduros entre os nucleotídeos 2 e 8. Os miRNAs maduros mir-2 mostraram como sequência consenso (no programa weblogo), entre os nucleotídeos 2 e 8, a sequência “AUCACAG”. Esta região tem sido considerada como uma das regiões principais para o pareamento e reconhecimento do gene alvo (Grimson et al., 2007). Todos os miRNAs mir-2 identificados neste trabalho mostraram esta sequência conservada exceto sma-miR-2f, sja-mir-2f e sma-mir-2a. Estes miRNAs apresentaram G como o segundo nucleotídeo ao invés de A, ocasionando em uma possível mudança no perfil de alvos e conseqüentemente no papel biológico desempenhado no organismo. 130

(160) Cluster Protostômio-específico mir-71/2 A comparação entre os Weblogos dos genes mir-2 e mir-13 mostrou diferentes frequências dos nucleotídeos em cada posição específica do miRNA maduro (Figura 43 e 44). A sequência consenso dos genes miR-13, entre as posições 1 e 8, mostrou uma contribuição máxima dos nucleotídeos “UAUCACAG”. Corroborando com a região consenso dos mir-13 conhecidos, os novos miRNAs mir-13 apresentaram 100% de identidade em relação a estes nucleotídeos nestas mesmas posições. O nucleotídeo com maior contribuição na posição 12, em mir-2 e mir-13, apresentou diferença. No caso de sequências maduras de mir-2 o nucleotídeo G apresentou maior contribuição, não sendo 100%. No entanto, a mesma posição em mir-13 foi representada por uma maior contribuição do nucleotídeo U. Corroborando com estas análises os novos miRNAs mir 13 apresentaram U na 12ª posição. No entanto, os novos mir-2 apresentaram preferencialmente G nesta posição, principalmente os miRNAs provenientes do clado Ecdysozoa (Figura 44). Foram identificados neste trabalho quatro mir-71, sendo três provenientes de espécies Ecdysozoans e um de Lophotrochozoans. A figura 45 mostra a distribuição dos nucleotídeos na sequência madura dos miRNAs mir-71. A representação Weblogo destas sequências mostrou uma contribuição majoritária de “GAAAGAC”, entre os nucleotídeos 2 e 8, e de G, G e A nas posições 18, 20 e 21, respectivamente. Corroborando com estes dados as sequências de miRNAs mir-71 identificadas, neste trabalho, apresentaram os mesmos nucleotídeos nestas posições específicas mostrando um alto grau de conservação relativo a sequências maduras destas moléculas. Figura 45: miRNAs maduros da família mir-71. Representação Weblogo das sequências maduras dos miRNAs mir-71 e as sequências maduras dos novos miRNAs identificados. A caixa cinza corresponde a região seed dos miRNAs maduros entre os nucleotídeos 2 e 8. Os resultados deste trabalho sugerem a presença do cluster de miRNA mir-71/2, possivelmente controlado pelo mesmo promotor, apenas em espécies de Protostômios, caracterizando-o como um cluster Protostômio-específico. A descoberta destes miRNAs, 131

(161) Cluster Protostômio-específico mir-71/2 ausentes em mamíferos, pode trazer benefícios no diagnóstico e controle de doenças causadas por espécies de Ecdysozoans e Lophotrochozoans. Estes resultados em sua totalidade estão em fase de conclusão para envio para revista Journal of Molecular Evolution com o título “Computational identification and evolution of microRNA gene cluster mir-71/2 in Protostomes” (Anexo 2). 132

(162) miRNAs: novos controladores da expressão gênica em S. mansoni? Capítulo VI miRNAs: novos controladores da expressão gênica em S. mansoni? 133

(163) miRNAs: novos controladores da expressão gênica em S. mansoni? VI.1 Justificativa Os miRNAs são reguladores pós-transcricionais que se ligam de forma complementar a RNA mensageiros nas células, usualmente, resultando no silenciamento gênico por repressão da tradução ou degradação dos alvos. A descoberta de novas formas de interação entre os miRNAs e seus alvos tem aumentado a cada dia, sugerindo que estas conexões foram instrumentos fundamentais para o aumento da complexidade dos organismos durante a evolução (Berezikov, 2011). O número de alvos de miRNAs por genoma é desconhecido. Tem sido sugerido que os genes silenciados por miRNAs ultrapassam 60% em humanos, tamanha a importância destas moléculas para as células (Friedman et al., 2009). Programas de predição de alvos de miRNAs tem usado várias estratégias baseadas em características específicas das moléculas miRNA e mRNA ou do pareamento miRNA/mRNA. Exemplos destas características são pareamento da região seed, termodinâmica do par miRNA/mRNA e análise evolutiva da região 3’UTR do mRNA alvo (Lindow, 2011). No entanto, o ajuste dos parâmetros e a escolha correta dos programas utilizados têm sido necessário para a obtenção de resultados mais confiáveis (Watanabe et al., 2007). Recentemente, diversos autores tem se dedicado à validação tanto das moléculas de miRNAs quanto de seus prováveis alvos. A validação tem permitido uma elucidação melhor dos processos em que os miRNAs e seus alvos participam na célula efetivamente. Por exemplo, em células cancerígenas, tem sido mostrado importância do regulamento dos miRNAs afetando a expressão de alguns alvos pró-oncogênicos (Farazi et al., 2011). Avançando o estudo computacional de miRNAs a validação dos miRNAs tem sido utilizadas utilizando Real Time, Northern Blot e sequenciamento. A técnica de Real Time tem sido bastante utilizada para identificação de miRNAs em diversos organismos já que pequenas quantidades de RNA são utilizadas para a medida de sua expressão. Exemplos de utilização desta técnica tem sido mostrada em camundongos, humanos, S. japonicum e outros (Zhang et al., 2009a; Cai et al., 2011; Chen et al., 2011). Assim como em outras espécies, os miRNAs no genoma de S. mansoni provavelmente desempenham papéis importantes e indispensáveis no desenvolvimento e diferenciação do parasito. Com o objetivo de entender a função biológica dos miRNAs identificados computacionalmente no genoma do parasito (capítulo IV) foi realizado a validação dos miRNAs maduros identificados e de seus prováveis alvos. Os miRNAs mostraram expressos em vários estágios de parasito, principalmente, em cercária e esquistossômulos, evidenciando miRNAs estágios-específicos e gênero-específicos. A busca 134

(164) miRNAs: novos controladores da expressão gênica em S. mansoni? de alvos conservados visou aumentar a estringência da análise em detrimento do número elevado de genes alvos, propiciando uma avaliação mais confiável do provável papel biológico que determinado miRNA tem exercido nas células do parasito. A avaliação da coexpressão dos miRNA e seu provável alvo também foi realizada utilizando Real Time. Ficou evidenciado uma provável correlação positiva da expressão dos miRNAs sma-mir-125a e sma-mir124-3p e de seus genes alvos sinoviolina e inexina. Estes fatos permitem mensurar a grande importância que os miRNAs exercem no organismo dirigindo ou bloqueando processos essenciais na célula. 135

(165) miRNAs: novos controladores da expressão gênica em S. mansoni? VI.2 Materiais e Métodos VI.2.1 Análise in silico VI.2.1.1 Predição computacional dos alvos de miRNAs no genoma de S. mansoni A predição computacional dos genes alvos no genoma do parasito foi realizada utilizando o par de sequências miRNAs maduros, identificados neste trabalho (Capítulo IV), e as 3`UTRs (Regiões da extremidade 3’ da fita de RNA mensageiro não traduzidas em proteína) preditas referentes aos respectivos RNAs mensageiros alvos de S. mansoni. VI.2.1.2 3’UTR dos mRNAs A recuperação das sequências 3’UTRs dos RNAs mensageiros de S. mansoni foi realizada utilizando informações posicionais do códon de parada do mRNA e da região não traduzida da molécula de RNA. Estas informações foram extraídas do arquivo de texto de anotação do genoma, GFF e GFF3, depositado no banco de dados GeneDB (www.genedb.org). As sequências de 3’UTRs encontradas na fita negativa do DNA foram invertidas, a fim de se obter a fita correspondente ao pareamento correto com o miRNA maduro. Esta etapa foi realizada utilizando a ferramenta EMBOSS “seqret”. Esta ferramenta foi aplicada em linha de comando na plataforma Linux após a instalação do pacote EMBOSS. As sequências foram separadas em um banco de dados de 3’UTRs em formato multi-fasta para posterior análise. VI.2.1.3 mRNAs alvos Para identificação dos RNAm alvos no genoma de S. mansoni o programa miRANDA foi utilizado com condições e parâmetros ajustados. Estes parâmetros foram ajustados baseados em identificações de alvos de miRNAs em diversas espécies como seres humanos e peixe zebra (John et al., 2004; Chen et al., 2005). Os valores referentes aos parâmetros foram: penalidade de abertura de espaço (“gap opening penalty”) −8, penalidade sobre expansão de espaço (“gap extension penalty”) −2, pontuação mínima aceitável entre o par miRNA maduro e 3`UTR 120, energia livre máxima entre o par miRNA maduro e 3’UTR −15 kcal/mol, escala utilizada para medida da pontuação de complementaridade entre o par miRNA e 136

(166) miRNAs: novos controladores da expressão gênica em S. mansoni? 3`UTR 3 e contagem a partir de 5′ final com demanda estrita na região semente do miRNA maduro (“seed region”) com 100% de pareamento entre o par (entre nucleotídeos 2 e 9). Estes parâmetros foram aplicados todos em linha de comando na plataforma Linux após a instalação do programa miRANDA na mesma plataforma. Os resultados positivos foram recuperados do arquivo final utilizando um script escrito em Perl. VI.2.1.4 Caracterização e Categorização dos RNAm alvos Os termos de ontologia gênica (“Gene Ontology Terms”) para as proteínas preditas foram obtidos a partir do banco de dados de S. mansoni (GeneDB). Os termos referentes aos alvos foram separados e utilizados para a categorização. Utilizou-se para esta categorização apenas os alvos com um delta G inferior a -20 kcal/mol quando comprados com seus respectivos miRNAs e contendo 100% de complementaridade na região seed do miRNA. O método de classificação de ontologia gênica utilizado foi a ferramenta “GO CateGOrizer” disponível no site (http://www.animalgenome.org/bioinfo/tools/countgo/). Esta ferramenta utiliza como método “GO Slim” para agrupar e contar as diferentes Classes de ontologia gênica (“GO Class”) dos alvos preditos. Os dados das proteínas preditas de S. mansoni relacionados a importantes informações funcionais foram obtidas na Enciclopédia Kyoto de Genes e Genomas (Kyoto Encyclopedia of Genes and Genomes – KEGG). VI.2.1.5 Predição de 3'UTR alvo homólogas Os alvos identificados em S. mansoni foram utilizados para busca de alvos homólogos em S. japonicum. Os alvos dos miRNAs conservados buscados em S. japonicum foram aqueles relacionados aos miRNAs intergênicos sma-mir-124-3p, sma-mir-8-3p, sma-mir-363p, sma-mir-61 e sma-mir-125a e os miRNAs intrônicos sma-mir-190 e sma-mir-3479-3p. Inicialmente, foi realizada uma busca por regiões similares no genoma de S. japonicum utilizando como sequência query a região 3`UTRs obtidas anteriormente para identificação dos mRNAs alvos em S. mansoni. Estas sequências 3`UTRs, com sinal positivo para alvo de miRNAs em S. mansoni, foram comparadas utilizando a ferramenta megablastn com os seguintes parâmetros modificados: -W 10 (“Word size” – tamanho da palavra buscada), –r 5 (“Match score” – Pontuação pelo pareamento correto), –q -4 (“Mismatch score” – pontuação pelo pareamento incorreto), –G 8 (“Gap Penalty” – penalidade por espaços na sequência 137

(167) miRNAs: novos controladores da expressão gênica em S. mansoni? alinhada) e -E 6 (“Gap Penalty” – penalidade por extensão dos espaços na sequência alinhada). Estes parâmetros foram utilizados a fim de se obter um alinhamento local próximo do requerido para sequências homólogas. Para confirmar o alinhamento local realizado, as sequências genômicas de S. japonicum referentes a cada 3`UTR foram recuperadas do banco de dados do parasito. Estas sequências foram utilizadas para comparação com as prováveis proteínas preditas próximas, a jusante ou a montante da sequência, dependendo de sua orientação na fita de DNA, a fim de se verificar a veracidade da predição da posição da região 3`UTR homóloga. A busca pela provável proteína homóloga em S. japonicum, relacionada com a 3`UTR positiva no teste anterior, foi realizada utilizando como query a proteína predita homóloga de S. mansoni correspondente. A sequência de aminoácido desta proteína foi comparada utilizando blastp com o banco de dados de proteínas preditas de S. japonicum. As proteínas homólogas de S. japonicum foram recuperadas, assim como suas respectivas posições, e comparadas com as posições das 3`UTRs positivas identificadas no genoma de S. japonicum. Considerou-se apenas as 3`UTRs que possuíam a mesma sequência, ou seja, 100% de identidade em relação a região de pareamento do miRNA correspondente e complementar a região seed do miRNA. Estas regiões foram então separadas em um arquivo de dados fasta para posterior comparação e identificação dos alvos utilizando os miRNAs homólogos. Os critérios para busca de alvos utilizando 3`UTRs homólogas e miRNAs homólogos de S. japonicum foram as mesmas utilizadas para a busca de alvos em S. mansoni, utilizando o programa miRANDA com parâmetros ajustados, exceto a energia livre de pareamento que foi alterada para -18 kcal/mol. VI.2.2 Análise in vitro VI.2.2.1 Obtenção dos Parasitos Neste trabalho, inicialmente os parasitos, cercária e vermes adultos foram obtidos no Institute of Molecular Medicine, Trinity College Health Sciences Centre, St. James Hospital (Dr. Padraig Fallon). Para realização das análises foram utilizados parasitos da espécie S. mansoni linhagem LE, em diferentes etapas do ciclo provenientes do Moluscário do CPqRR/FIOCRUZ (Centro de Pesquisa René Rachou, Fundação Oswaldo Cruz)(Dr. Liana K. Jannotti-Passos) em Belo Horizonte/MG. Os vermes adultos foram obtidos a partir da perfusão do sistema porta-hepático de camundongos da linhagem Swiss Webster infectados com aproximadamente 100 cercárias 138

(168) miRNAs: novos controladores da expressão gênica em S. mansoni? por via subcutânea após 50 dias, conforme descrito por Smithers e Terry (1965) (Smithers and Terry, 1965). Após a coleta, os vermes adultos foram separados em meio RPMI com auxílio de pincéis estéreis e posteriormente armazenados em tubo eppendorfs de 1,5 ml a 80ºC até utilização. As cercárias foram obtidas após 27 a 31 dias de infecção do hospedeiro intermediário Biomphalaria glabrata com miracídeos. Posteriormente a cercária, foi separada do sobrenadante e das impurezas contidas no meio e armazenada em tubos de 1,5 ml a -80ºC para posterior utilização. Os esquistossômulos mecanicamente transformados foram obtidos através da forma larval cercária. Inicialmente as cercárias frescas, após banho de gelo (2 horas) e separação das impurezas, foram transferidas para tubos falcons de 15 mL, com aproximadamente 200.000 cercárias por tubo, contendo 5 mL de RPMI 1640 (INVITROGEN). Após a separação mecânica entre a cauda e o corpo cercariano foi adicionado RPMI suplementado com 10% de penicilina / estreptomicina100 mg/mL, e incubado em estufa de CO2 5% a 37C por 3 horas e meia (Harrop and Wilson, 1993). O cultivo dos esquistossômulos foi realizado em meio 169 suplementado com 10% de soro fetal bovino (Gibco) e 1% penicilina / estreptomicina100 mg/mL por poço. Os vermes foram cultivados durante 3,5 e 24 horas. VI.2.2.2 Extração de RNA total VI.2.2.2.1 miRNAs Aproximadamente 50 mg de vermes adultos machos e fêmeas, cercárias e esquistossômulos recém-transformados 3,5 e 24 horas foram utilizados para extração de RNA total enriquecido com pequenos RNAs utilizando o kit miRNeasy (Qiagen) seguindo o protocolo do fabricante. Brevemente, as amostras biológicas foram homogeneizadas em 700 μl QIAzol Lysis Reagent com auxílio de um homogeneizador tipo politron. Posteriormente, o homogeneizado foi transferido para tubos eppendorf de 1,5 mL e incubado por cinco minutos à temperatura ambiente para permitir a completa dissociação dos complexos de nucleoproteínas. A seguir foram adicionados 140 μl de clorofórmio (Sigma - St. Louis, MO, USA) para cada amostra. A mistura foi homogeneizada vigorosamente com auxílio de um vórtex. Em seguida, as amostras foram centrifugadas por 12 minutos a 12.000g a 4ºC. A fase aquosa foi transferida 139

(169) miRNAs: novos controladores da expressão gênica em S. mansoni? para um novo tubo seguido da adição de 1,5 vezes o volume equivalente de etanol 100% e homogeneizado suavemente por inversão o tubo, por três vezes, para a precipitação do RNA. A seguir o RNA total foi purificado conforme instrução do boletim técnico do fabricante. A padronização da metodologia foi avaliada em gel de agarose/formaldeído 1,2%. A pureza e quantificação dos RNAs foram determinadas utilizando o aparelho NanoDrop (GE) avaliando as relações entre os comprimentos de onda 260/280 e 260/230 indicativos de pureza das amostras. VI.2.2.2.2 Alvos Cerca de 100 mg de verme adulto casal e cercária foram utilizados para extração de RNA total utilizando o kit RNA total (SV total RNA Isolation System - PromegaTM) seguindo o protocolo do fabricante. A amostra biológica foi homogeneizada em 1 mL de TRIzol® Reagent (InvitrogenTM) com auxílio de um homogeneizador tipo politron. Posteriormente, o homogeneizado foi transferido para tubos eppendorf de 1,5 mL e incubado por cinco minutos à temperatura ambiente para permitir a completa dissociação dos complexos de nucleoproteínas. A seguir foram adicionados 0,2 mL de clorofórmio (Sigma - St. Louis, MO, USA) para cada 1,0 mL de TRIzol. A mistura foi homogeneizada vigorosamente com auxílio de um vórtex. Em seguida, as amostras foram centrifugadas por 10 minutos a 12.000g a 4ºC. A fase aquosa foi transferida para um novo tubo seguido da adição de volume equivalente de etanol 95% v/v (preparado com água livre de RNAses) e homogeneizado suavemente por inversão o tubo, por três vezes, para a precipitação do RNA. A seguir o RNA total foi purificado com o kit SVRNA System conforme instrução do boletim técnico do fabricante. A padronização da metodologia foi avaliada em gel de agarose/formaldeído, como mostra a Figura 46. A pureza e quantificação dos RNAs foram determinadas utilizando o aparelho NanoDrop (GE) avaliando as relações entre os comprimentos de onda 260/280 e 260/230 indicativos de pureza do amostra. 140

(170) miRNAs: novos controladores da expressão gênica em S. mansoni? Figura 46: RNA total obtido a partir de formas evolutivas do S. mansoni. O RNA total foi obtido utilizando o kit SV40 a partir de verme adulto (1) e cercária (2) VI.2.2.3 Obtenção da primeira fita de DNA (cDNA) VI.2.2.3.1 miRNAs A primeira fita do cDNA foi sintetizada utilizando 1µg de RNA total extraído e o Kit miScript Reverse Transcription (Qiagen), seguindo as recomendações dadas pelo fabricante. Brevemente, para cada 1µg de RNA total enriquecido com pequenos RNAs, foram utilizados 4 μL miScript RT Buffer 5x, 1μL de transcriptase reversa (miScript Reverse Transcriptase Mix) e água livre de RNAse para um volume final de 20 μL. A mistura foi incubada a 35°C por 60 minutos, seguidos de 5 minutos a 95°C, com auxílio de um termociclador (Biocycler, version 3.2). As amostras foram estocadas a -20°C até o momento do uso. VI.2.2.3.2 Alvos A primeira fita do cDNA foi sintetizada utilizando 1µg de RNA total extraído e o Kit High Capacity RT-PCR System (Applied Biosystems), seguindo as recomendações dadas pelo fabricante. Para cada 1µg de RNA total, foram utilizados 2 μL de iniciadores randômicos (10x RT Random primer), 0,8 μL de dNTPs [25x dNTP Mix (100mM)], 1μL de transcriptase reversa (Multi Scribeä Reverse Transcriptase) e água livre de RNAse para um volume final de 10 μL. A mistura foi incubada a 25°C por 10 minutos, seguidos de 120 minutos a 37°C e 85° por 5 minutos, com auxílio de um termociclador (Biocycler, version 3.2). A amostra ficou estocada a -20°C até o momento do uso. VI.2.2.4 Oligonucleotídeos iniciadores 141

(171) miRNAs: novos controladores da expressão gênica em S. mansoni? VI.2.2.4.1 miRNAs Os oligonucleotídeos iniciadores específicos para os miRNAs em estudo foram baseados nas sequências maduras dos miRNAs identificados neste trabalho (Tabela 12). Estes primers foram utilizados para posterior PCR em tempo real. Tabela 12: Número de acesso das sequências e oligonucleotídeos iniciadores referentes aos miRNAs avaliados. miRNAs maduros Tamanho (nt) Sequência Madura - Primer (5`a 3`) 21 TAAGGCACGCGGTGAATGTCA sma-mir-124-3p 22 TCCCTGAGACCCTTTGATTGCC sma-mir-125a 23 TGATATGTATGGGTTACTTGGTG sma-mir-190-5p 22 TATTGCACTAACCTTCGCCTTG sma-mir-3479-3p 23 CCACCGGGTAGACATTCATTCGC sma-mir-36-3p 22 TGACTAGAAAGTGCACTCACTT sma-mir-61 23 TAATACTGTTAGGTAAAGATGCC sma-mir-8-3p 22 TTATTTCCAAAACCTTGACGGA sma-mir-new_10-5p 20 ACGATACAGAGAAGATTAGC sma-u6 VI.2.2.4.2 Alvos Os oligonucleotídeos iniciadores específicos para os genes em estudo, foram baseados nas sequências de mRNA depositadas no banco de dados GeneDB (http://www.genedb.org/Homepage/Smansoni) e idealizados pelo programa Gene Runner (Version 3.05), conforme a Tabela 13. Para evitar a amplificação de DNA genômico, o par de primers de cada gene foi desenhado entre regiões intrônicas. A tabela 2 mostra os primers com suas respectivas sequências de nucleotídeos. Tabela 13: Número de acesso das sequências e oligonucleotídeos iniciadores referentes aos alvos de miRNAs. Gene Tamanho (nt) Sequência - Primer (5`a 3`) Smp_177060 132 F CTTGGTTATCAGTGTGTGGAGC 132 R GAGCTTCTGCGACTACTACTGC 142 F TTGGGATCGTACATAAATGC 142 R AAACCAGTGAGACCCATTG 87 F GCAGGATACACAGCAAACTC 87 R TGGTTCTGGGTTCACATC Smp_066900 Alfa-tubulina 142

(172) miRNAs: novos controladores da expressão gênica em S. mansoni? VI.2.2.5 qRT-PCR VI.2.2.5.1 miRNA Para análise da expressão dos miRNAs em estudo foi utilizada a técnica de PCR em tempo real. As reações foram realizadas pelo kit SYBR Green detection (miScript Primer Assay – Qiagen) em placas de 96 poços (MicroAmp® Optical 96 Well Reaction Plate – Applied Biosystems) e seladas com adesivo óptico (MicroAmp® Optical Adhesive Film – Applied Biosystems) ao final do procedimento. Foram pipetados 2 μL dos iniciadores (na concentração de 2,5 μM) em triplicata, 2 μL de cDNA diluído 10 vezes, 1 μL de 10x miScript Universal Primer e 5 μL de 2x QuantiTect SYBR Green PCR Master Mix, totalizando um volume de reação em cada poço de 10 μL. Os ensaios foram realizados em triplicata biológica para todos os miRNAs avaliados, com o controle endógeno presente em todas as placas (u6). Os valores de baseline (ciclos iniciais em que há pequenas alterações na fluorescência) foram ajustados para 3-15 ciclos. O threshold, desvio padrão médio do repórter normalizado (Rn) para os ciclos iniciais da PCR multiplicado por um fator ajustável, foi ajustado à região associada ao crescimento exponencial do produto da PCR e, portanto, fixado em 0,02 para todas as amostras, uma vez que se comparou o mesmo miRNA em diferentes estágios. O Rn refere-se à relação entre a intensidade de fluorescência emitida pelo corante repórter pela intensidade de fluorescência emitida pelo corante da referência passiva (ROX). As análises foram feitas pelo método de quantificação relativa da expressão gênica (ΔCT), que permite quantificar diferenças no nível de expressão de um alvo específico entre as diferentes amostras. Os níveis dos miRNAs alvos foram normalizados pelos níveis do controle endógeno. Os resultados foram alcançados por uma fórmula aritmética que considera a quantidade do alvo, normalizado (2-∆CT). A reação de qRT-PCR foi conduzida conforme seguinte programação: 15 min a 95 °C, seguido por 40 ciclos de 94 °C por 15 s, 55 °C por 30 s e 70 °C por 30 s. VI.2.2.5.2 Alvos Para análise da expressão dos genes em estudo foi utilizada a técnica de PCR em tempo real. As reações foram realizadas pelo kit SYBR® Green PCR Master Mix (Applied Biosystems) em placas de 96 poços (MicroAmp® Optical 96 Well Reaction Plate – Applied 143

(173) miRNAs: novos controladores da expressão gênica em S. mansoni? Biosystems) e seladas com adesivo óptico (MicroAmpä Optical Adhesive Film – Applied Biosystems) ao final do procedimento. Foram pipetados 3 μL dos iniciadores (na concentração de 2,5 μM) em triplicata e 7 μL de um mix de reação contendo 2 μL de cDNA diluído 5 vezes (com água livre de DNAse) e 5 μL de SYBR ® Green Master Mix, totalizando um volume de reação em cada poço de 10 μL. Os ensaios foram realizados em triplicata biológica para todos os genes avaliados, com o controle endógeno presente em todas as placas. Os valores de baseline (ciclos iniciais em que há pequenas alterações na fluorescência) foram ajustados para 3-15 ciclos. O threshold, desvio padrão médio do repórter normalizado (Rn) para os ciclos iniciais da PCR multiplicado por um fator ajustável, foi ajustado à região associada ao crescimento exponencial do produto da PCR e, portanto, fixado em 0,2 para todas as amostras, uma vez que se comparou o mesmo gene em diferentes grupos. O Rn refere-se à relação entre a intensidade de fluorescência emitida pelo corante repórter pela intensidade de fluorescência emitida pelo corante da referência passiva (ROX). As análises foram feitas pelo método de quantificação relativa da expressão gênica (ΔCT), que permite quantificar diferenças no nível de expressão de um alvo específico entre as diferentes amostras. Os níveis dos genes alvos foram normalizados pelos níveis do controle endógeno. Os resultados foram alcançados por uma fórmula aritmética que considera a quantidade do alvo, normalizado (2-∆CT). A reação de qRT-PCR foi conduzida conforme programação contida no aparelho ABI 7300 Applied Biosystems. VI.2.2.5.2.1 Curva de eficiência dos iniciadores Para determinar as eficiências relativas da amplificação dos alvos e do controle endógeno foram construídas curvas padrões para cada amplicon a partir de uma mesma amostra (Figura 47 e 48). O ensaio foi realizado em triplicata e a concentração dos iniciadores foi de 2,5 μM. A curva padrão foi representada por um gráfico de regressão linear semi-log do valor de CT (eixo Y) em comparação ao log da quantidade inicial do ácido nucléico (eixo X). Foi utilizado o cDNA de cercária em cinco diluições seriadas de quatro vezes. O slope da curva padrão foi usado para estimar a eficiência de amplificação. Uma reação 100% eficiente produzirá um aumento de dez vezes no amplicon da PCR a cada 3,32 ciclos durante a fase exponencial de amplificação (log2 10 = 3, 3219), ou seja, o amplicon dobra em quantidade durante a fase geométrica. O cálculo da estimativa da eficiência (E) foi 144

(174) miRNAs: novos controladores da expressão gênica em S. mansoni? calculado pela fórmula: E= (10-1/slope – 1) x 100. Os iniciadores foram considerados apropriados para avaliar a expressão gênica pelo sistema SYBR® Green quando apresentaram eficiência de reação acima de 80% e abaixo de 120%. Os valores de baseline foram ajustados para 3-15 ciclos e o threshold fixado em 0,1 para todas as amostras. Figura 47: Plot de amplificação referente à curva de eficiência do gene α tubulina. Em X está demonstrado o valor dos ciclos de PCR e em Y os valor de ∆Rn. Foi utilizado cDNA de cercária e uma diluição seriada de 4 vezes. Figura 48: Curva padrão referente ao gene α tubulina. Em X estão demonstrados os valores de Log da concentração de cDNA e em Y os valores de CT correspondes a cada diluição. Os valores de slope e de coeficiente de linearidade estão representados a direita do gráfico. Foi utilizado cDNA de cercária e uma diluição seriada de 4 vezes. VI.2.2.5.2.2 Curva de dissociação dos amplicons Foi realizada a análise da curva de dissociação dos amplicons para identificar a formação de produtos inespecíficos no final de cada corrida, possivelmente gerados a partir de excesso de iniciadores ou falha no desenho dos mesmos. 145

(175) miRNAs: novos controladores da expressão gênica em S. mansoni? Ao final dos 40 ciclos da qRT-PCR, a temperatura foi elevada gradualmente de 60 à 95ºC, mantendo-se por 15 segundos em cada grau Celsius. Na medida em que os amplicons desnaturaram, o sinal fluorescente emitido pelo SYBR® Green foi reduzido e a temperatura em que metade do produto da PCR estava dissociada medida. O gráfico resultante permitiu verificar se houve um ou mais produtos de PCR presentes em cada reação devido a diferenças de temperatura de melting (Tm), específicas e dependentes do tamanho do fragmento e do conteúdo de GC (%GC). O Tm desejado foi acima de 80°C. VI.2.2.6 Análise estatística A expressão relativa dos microRNAs e seus alvos nos diversos estágios analisados foi comparada pela análise da variância (ANOVA) por ONE-WAY (Teste de Tukey) e o teste T de Student, quando adequado. Foi considerado estatisticamente significante amostras com p < 0,05. A análise estatística foi realizada pelo programa PRISMA (GraphPad Prism 5). 146

(176) miRNAs: novos controladores da expressão gênica em S. mansoni? VI.3 Resultados e Discussão VI.3.1 Predição dos alvos de miRNAs Utilizando o banco de dados de S. mansoni foi possível a recuperação das regiões 3’UTRs a partir dos genes preditos depositados no GeneDB. Até o momento apenas 6261 genes apresentam 3 UTRs mapeadas nos arquivos de genoma de S. mansoni. A subestimação do número de genes com 3`UTRs preditas se deve ao fato de nem todos possuírem anotação nas bases de dados do genoma (GeneDB) presentes nos arquivos GFF ou GFF3. Utilizando a ferramenta de predição de alvos de miRNAs miRANDA foi possível a predição 389 alvos dentro dos 6261 genes analisados. Os parâmetros foram ajustados para manter 100% de complementaridade entre a região seed (2-8 nt) do miRNA maduro (extremidade 5`) e a parte da 3`UTR do gene alvo aumentando a especificidade da predição. Os mesmos parâmetros utilizados pelo programa miRANDA foram estabelecidos em humanos e peixe zebra (John et al., 2004; Chen et al., 2005). A tabela 14 mostra os miRNAs preditos de S. mansoni e seus prováveis alvos no genoma do parasito. Dos 67 miRNAs maduros preditos no genoma de S. mansoni, 50 apresentaram pelo menos um provável gene alvo no banco de 3’UTRs do parasito (Tabela 14). Alguns miRNAs não apresentaram genes alvos preditos no genoma devido à estringência utilizada neste trabalho, com parâmetros de score mínimo 80 e delta G máximo de -20 kcal/mol. Assim, o método de predição do alvo visou descartar os falso positivos no conjunto total. O maior número de alvos preditos, 200 no total, foi identificado para o conjunto de miRNAs presentes nos 2 clusteres encontrados no parasito, sma-mir-71/2 e sma-mir-71b/2 (12 diferentes formas maduras de miRNAs). Isto representa mais do que 50% de todos os alvos identificados nesta análise. O número grande de alvos destes miRNAs sugere uma participação importante destes genes na regulação da expressão gênica no parasito. Outros organismos também tem mostrado números relevantes de genes preditos regulados por miRNAs da família mir-71 e mir-2 como C. elegans e D. melanogaster. Os programas de predição TargetScanWorm (http://www.targetscan.org/worm_12/) e TargetScanFly (http://www.targetscan.org/fly/) mostram esta tendência elevada em relação ao número de alvos preditos para mir-2 e mir-71. Em C. elegans a predição de alvos para os miRNAs cel-mir-71 e cel-mir-2 tem gerado mais de 500 predições, enquanto em D. melanogaster para os genes dme-mir-2 quase 300 alvos foram preditos. A critério de comparação, no caso do gene miRNA let-7 os programas TargetScanWorm e TargetScanFly tem predito 65 e 38 alvos, respectivamente. Em S. mansoni o gene ortólogo sma-mir-let-7 147

(177) miRNAs: novos controladores da expressão gênica em S. mansoni? teve como alvos preditos apenas 9 mRNAs (Tabela 14). Isto enfatiza a importância destes miRNAs não apenas no controle da regulação gênica no parasito S. mansoni, mas em outros organismos em geral. Entre os 67 miRNAs identificados, o miRNA sma-mir-71 obteve o maior número de alvos preditos isoladamente (Tabela 14). Para este miRNA foram preditos 42 genes alvos (Tabela 14). Algumas sequências de 3`UTRs apresentaram mais de um sítio de ligação para diferentes miRNAs, como por exemplo a região 3`UTR do gene Smp_184330 (“hypothetical gene”) identificada como alvo dos miRNAs, sma-mir-71b-3p e sma-mir-31-5p. Por outro lado, alguns miRNAs apresentaram vários sítios dentro da mesma 3`UTR como por exemplo, o miRNA sma-mir-2b-5p que apresentou 2 sítios na 3`UTR do gene Smp_110400.3. Tem sido mostrado que a mesma região 3`UTR pode ter mais de um sítio de miRNAs (TargetScan). A predição de mais de um sítio de complementaridade do miRNA na região 3`UTR tem sido considerado um indício positivo para e efetiva atuação do miRNA em seu gene alvo (Lewis et al., 2005). Entre os genes de miRNAs duplicados, sma-mir-71 e sma-mir-71b foram observados repertórios de alvos similares, sendo 22 alvos iguais e 20 diferentes (Tabela 14) (de Souza Gomes et al., 2011). Estes dados consistem com a alta similaridade entre as duas sequências maduras dos miRNAs principalmente na região seed. No entanto, não apenas a região seed do miRNA maduro influencia na interação entre as moléculas miRNA/mRNA, mas também os nucleotídeos vizinhos, gerando um dupléx estável ou instável. Alguns alvos se mostraram específicos de sma-mir-71 e outros de sma-mir-71b. Vale ressaltar que os alvos do miRNA alocado no cromossomo W, sma-mir-71, são regulados apenas em fêmeas sugerindo uma provável função fêmea específica. Dentre os genes alvos de sma-mir-71 preditos neste trabalho, 5 destacam-se apresentando alta homologia com HSP40 DNAj de H. sapiens (Smp_078800, Smp_049600.1, Smp_049600.2, Smp_049600.3 e Smp_049600.4). Trabalhos anteriores têm mostrado que o gene DNAj está associado com receptores esteroidais responsáveis por promover mudanças em sua conformação em sinal a presença de hormônio esteróide. Em mamíferos (específicamente camundongos fêmeas) a deleção desta proteína DNAj (DjA -/-) promove o crescimento e fertilidade normal do organismo. Por outro lado, machos de camundongo, com esta mesma deleção, sofrem severos defeitos na espermatogênese e são inteiramente inférteis (Cintron and Toft, 2006). O miRNA sma-mir-71 provavelmente atua em vermes fêmeas reprimindo sua maturação sexual. As fêmeas de S. mansoni são imaturas e requerem a presença do verme macho para adquirir maturidade sexual. As fêmeas sem contato com vermes machos serão 148

(178) miRNAs: novos controladores da expressão gênica em S. mansoni? sexualmente imaturas não atingindo a maturidade sexual (Erasmus, 1973). O miRNA smamir-71 tem como prováveis alvos os genes homólogos de DNAj, podendo assim, ter sua possível função relacionada com a repressão gênica em momentos de não contato da fêmea com o macho, apresentando um impacto significante na maturação sexual de fêmeas de S. mansoni 149

(179) miRNAs: novos controladores da expressão gênica em S. mansoni? Tabela 14: Número de prováveis RNA mensageiros alvos dos miRNAs maduros identificados no genoma de S. mansoni. miRNA sma-bantam sma-let-7 sma-mir-10-3p sma-mir-10-5p sma-mir-124-3p sma-mir-124-5p sma-mir-125a sma-mir-190-3p sma-mir-190-5p sma-mir-212 sma-mir-2162-3p sma-mir-250 sma-mir-281 sma-mir-2a-3p sma-mir-2a-5p sma-mir-2b-3p sma-mir-2b-5p sma-mir-2c-3p sma-mir-2c-5p sma-mir-2d-3p sma-mir-2e-3p sma-mir-2e-5p sma-mir-3011 sma-mir-31-5p sma-mir-3479-3p sma-mir-3492 Região “Seed” (2-8nt) GAGAUCG GAGGUAG AAUUCGA ACCCUGU AAGGCAC CAUUUUC CCCUGAG AGUGACC GAUAUGU AACAGUC AUUAUGC CUUCAGU GUCAUGG CACAGCC AGUCAAU AUCACAG GUCUCAA AUCACAG CCCUUGU AUCACAG AUCACAG ACCAACU UGAUUUU GGCAAGA AUUGCAC UCCGUGC No de alvos 4 9 0 4 16 6 5 2 10 6 0 1 1 22 10 29 6 21 5 24 16 3 2 15 0 6 sma-mir-36-3p sma-mir-61 sma-mir-71 sma-mir-71b-3p sma-mir-71b-5p sma-mir-8-3p sma-mir-8-5p CACCGGG GACUAGA GAAAGAC CUCAUAC GAAAGAC AAUACUG AUCUUAC 7 4 42 1 22 2 2 Alvo mais provável – miRanda* Ribonucleoprotein (hnrnp), putative (Smp_179270.2) Lar interacting protein (lip)-related protein (Smp_149910) N/A Hypothetical protein (Smp_177580) Ferritin, putative (Smp_047660) Dihydropyridine-sensitive l-type calcium channel, putative (Smp_124530) Expressed protein (Smp_114220) Expressed protein (Smp_062620.1) Multiple pdz domain protein, putative (Smp_154490) Expressed protein (Smp_084620) N/A Ap endonuclease, putative (Smp_167500) TGF-beta signal transducer Smad2, putative (Smp_085910) Serine palmitoyltransferase 1 (Smp_028080) Expressed protein (Smp_080370.1) Tropomyosin, putative (Smp_031770.15) Expressed protein (Smp_041050.2) Kinase (Smp_086690) Camp-regulated phosphoprotein, putative (Smp_090150.1) Cytoplasmic dynein light chain, putative (Smp_051400) Expressed protein (Smp_127690) Expressed protein (Smp_006840) Camp-regulated phosphoprotein, putative (Smp_090150.1) Hypothetical protein (Smp_110270) N/A Chmp1 (chromatin modifying protein) (charged multivesicular body protein), putative (Smp_055880.1) Topbp1, putative (Smp_133990.1) Transducin-like enhancer protein 1 (Smp_150080) Multidrug resistance protein 1, 2, 3 (p glycoprotein 1, 2, 3), putative (Smp_137080) Hypothetical protein (Smp_184330) Expressed protein (Smp_006840) Snare protein ykt6, putative (Smp_047450) Oxysterol binding protein 9, putative (Smp_174070) 150

(180) miRNAs: novos controladores da expressão gênica em S. mansoni? sma-mir-92ª sma-mir-9c sma-mir-new_1-3p sma-mir-new_1-5p sma-mir-new_2-3p sma-mir-new_2-5p sma-mir-new_3-3p sma-mir-new_3-5p sma-mir-new_4-3p sma-mir-new_4-5p sma-mir-new_5-3p sma-mir-new_5-5p sma-mir-new_6-3p sma-mir-new_6-5p sma-mir-new_7-3p sma-mir-new_7-5p sma-mir-new_8-3p sma-mir-new_8-5p sma-mir-new_9-3p sma-mir-new_9-5p sma-mir-new_10-3p sma-mir-new_10-5p sma-mir-new_11-3p sma-mir-new_11-5p sma-mir-new_12-3p sma-mir-new_12-5p sma-mir-new_13-3p sma-mir-new_13-5p sma-mir-new_14-3p sma-mir-new_14-5p sma-mir-new_15-3p sma-mir-new_15-5p sma-mir-new_16-3p sma-mir-new_16-5p AUUGCAC CUUUGGU AAGCUUC UAAGCUG GUGUUUC GGAAAAC AUUUUCU UAUUUCA CGCUUUA GCAGGUA UAAUUUC CCAAAGU CAAUCUC UCAGUAU AGCUUAG AGAGUUU CAUACUG AACAUAA ACAGCAG GGGAAAC AUUCGUC UAUUUCC AUUCAUC GAAACAG UUGUUAU UCACAGC UUUCUAU GCUAGAC AAAACUU UCAUUGU UCCAGGU GUUAAAC UUACAAG GAACGUU 0 0 1 0 0 4 1 0 0 2 0 4 3 16 3 8 7 0 1 5 2 2 1 2 0 0 2 9 0 0 13 0 0 0 N/A N/A Conserved hypothetical protein (Smp_164860) N/A N/A Monocarboxylate transporter, putative (Smp_150340) Actin-related protein 2, arp2 (Smp_101290.1) N/A N/A Rac-alpha serine/threonine-protein kinase (Smp_073930.2) N/A Hypothetical protein (Smp_006960) SWI/SNF complex-related (Smp_152650) Protein C10orf118 (CTCL tumor antigen HD-CL-01/L14-2), putative (Smp_034940.3) Fructose-1,6-bisphosphatase-related (Smp_097370) Fructose-1,6-bisphosphatase-related (Smp_097370) Expressed protein (Smp_015530.1) N/A Expressed protein (Smp_121440) Ectonucleotidepyrophosphatase/phosphodiesterase,putative (Smp_153340.1) Snf7-related (Smp_010090) Hypothetical protein (Smp_178030) Mevalonate 5 pyrophosphate decarboxylase (Smp_172660) Sodium-dependent phosphate transporter, putative (Smp_171630) N/A N/A Solute carrier family 35 member d1, putative (Smp_178490) Monocarboxylate transporter, putative (Smp_150340) N/A N/A Expressed protein (Smp_177040) N/A N/A N/A  Regiões 3’UTR com maior pontuação utilizando o software miRAnda. 151

(181) miRNAs: novos controladores da expressão gênica em S. mansoni? VI.3.2 Ontologia gênica e participação em vias metabólicas A estratégia de ontologia gênica foi necessária para observar os processos metabólicos que os alvos de miRNAs atuam. Vários algoritmos tem sido criados associando alvos de miRNAs com dados de ontologia gênica (Lall et al., 2006; Sethupathy et al., 2006a; Cui et al., 2007; Megraw et al., 2007). Neste trabalho, a ontologia gênica dos alvos relacionados com os miRNAs identificados em S. mansoni foi avaliada. Para identificação de quais associações (processos biológicos, funções moleculares ou componentes celulares) estariam relacionados aos alvos identificados em S. mansoni, os termos de ontologia gênica (“GO terms”) de cada sequência foram recuperados no banco de dados do parasito (GeneDB). Estes termos foram categorizados utilizando a ferramenta GO CateGOrizer (http://www.animalgenome.org/bioinfo/ tools/countgo/) com o modelo “GO Slim”. Os termos relacionados com atividade catalítica e metabolismo foram representados em quase 20% dos termos de ontologia gênica dos alvos analisados. A maioria das funções clássicas, relacionadas aos genes alvos de miRNAs, foi encontrada neste trabalho (Tabela 15)(Figura 49). Isto mostra que os processos em S. mansoni mantiveram-se consevados corroborando com outras espécies. Tabela 15: Ontologia gênica de miRNA em S. mansoni. Classe GO Definição (termos GO) GO:0003824 Função Molecular catalytic activity Contagem de “GO terms” Porcentagem 89 10,60% GO:0005488 binding 53 6,31% GO:0016787 hydrolase activity 36 4,29% GO:0016740 transferase activity 26 3,10% GO:0005215 transporter activity 19 2,26% GO:0003676 nucleic acid binding 11 1,31% GO:0005515 protein binding 10 1,19% GO:0004871 signal transducer activity 8 0,95% GO:0005216 ion channel activity 7 0,83% GO:0000166 nucleotide binding 7 0,83% GO:0008233 peptidase activity 6 0,71% GO:0004672 protein kinase activity 6 0,71% GO:0016301 kinase activity 6 0,71% GO:0003677 DNA binding 6 0,71% GO:0004872 receptor activity 6 0,71% GO:0030234 enzyme regulator activity 6 0,71% GO:0030528 transcription regulator activity 5 0,60% GO:0003723 RNA binding 3 0,36% 152

(182) miRNAs: novos controladores da expressão gênica em S. mansoni? GO:0004518 nuclease activity 3 0,36% GO:0005198 structural molecule activity 3 0,36% GO:0003774 motor activity 2 0,24% GO:0004721 phosphoprotein phosphatase activity 2 0,24% GO:0008092 cytoskeletal protein binding 2 0,24% GO:0008289 lipid binding 2 0,24% GO:0030246 carbohydrate binding 2 0,24% GO:0005102 receptor binding 1 0,12% GO:0003682 chromatin binding 1 0,12% GO:0045182 translation regulator activity 1 0,12% GO:0003700 transcription factor activity 1 0,12% GO:0008135 translation factor activity, nucleic acid binding 1 0,12% GO:0003779 actin binding 1 0,12% GO:0005509 calcium ion binding 1 0,12% Processos Biológicos GO:0008152 metabolism 79 9,40% GO:0006139 32 3,81% GO:0009058 nucleobase, nucleoside, nucleotide and nucleic acid metabolism biosynthesis 30 3,57% GO:0006810 transport 23 2,74% GO:0019538 protein metabolism 19 2,26% GO:0016043 cell organization and biogenesis 15 1,79% GO:0005975 carbohydrate metabolism 10 1,19% GO:0006259 DNA metabolism 9 1,07% GO:0006811 ion transport 9 1,07% GO:0007165 signal transduction 8 0,95% GO:0007154 cell communication 8 0,95% GO:0006350 transcription 8 0,95% GO:0006996 organelle organization and biogenesis 8 0,95% GO:0009056 catabolism 8 0,95% GO:0006464 protein modification 7 0,83% GO:0006412 protein biosynthesis 6 0,71% GO:0006629 lipid metabolism 6 0,71% GO:0015031 protein transport 4 0,48% GO:0006519 amino acid and derivative metabolism 4 0,48% GO:0016032 viral life cycle 4 0,48% GO:0007010 cytoskeleton organization and biogenesis 4 0,48% GO:0006950 response to stress 4 0,48% GO:0007049 cell cycle 4 0,48% GO:0000003 reproduction 3 0,36% GO:0006091 generation of precursor metabolites and energy 3 0,36% GO:0030154 cell differentiation 2 0,24% GO:0007275 development 2 0,24% GO:0019725 cell homeostasis 2 0,24% GO:0016265 death 1 0,12% GO:0009653 morphogenesis 1 0,12% GO:0008283 cell proliferation 1 0,12% 153

(183) miRNAs: novos controladores da expressão gênica em S. mansoni? GO:0008219 cell death 1 0,12% Componentes Celulares GO:0005623 cell 61 7,26% GO:0005622 intracellular 46 5,48% GO:0005737 cytoplasm 23 2,74% GO:0005634 nucleus 10 1,19% GO:0005856 cytoskeleton 5 0,60% GO:0005886 plasma membrane 4 0,48% GO:0005654 nucleoplasm 4 0,48% GO:0005739 mitochondrion 3 0,36% GO:0005694 chromosome 3 0,36% GO:0005840 ribosome 2 0,24% GO:0005783 endoplasmic reticulum 2 0,24% GO:0016023 cytoplasmic membrane-bound vesicle 2 0,24% GO:0005829 cytosol 2 0,24% GO:0005576 extracellular region 2 0,24% GO:0005764 lysosome 2 0,24% GO:0005773 vacuole 2 0,24% GO:0005768 endosome 2 0,24% GO:0005794 Golgi apparatus 2 0,24% GO:0005929 cilium 1 0,12% GO:0005615 extracellular space 1 0,12% GO:0005635 nuclear membrane 1 0,12% GO:0030312 external encapsulating structure 1 0,12% GO:0005618 cell wall 1 0,12% TOTAL 840 100,00% Figura 49: Representação dos termos “GO” associados aos alvos de miRNAs em S. mansoni. Os termos GO foram contados por contagem única representando um total de 127 termos ancestrais GO-Slim. 154

(184) miRNAs: novos controladores da expressão gênica em S. mansoni? A associação dos miRNAs, seus alvos e as vias metabólicas tem sido utilizadas em alguns programas para predição de miRNAs (Gaidatzis et al., 2007; Maragkakis et al., 2009; Papadopoulos et al., 2009). As correlações entre miRNAs e rotas bioquímicas tem o intuito de avaliar e anotar funcionalmente determinado miRNA, gerando especulações de atuação deste gene em determinada situação. Assim, neste trabalho, os miRNAs identificados e seus alvos preditos foram associados as vias metabólicas utilizando a Enciclopédia de genes KEGG. Os termos de cada gene do parasito foram recuperados do ftp da Enciclopédia KEGG e comparados com o repertório de genes alvos de miRNAs do parasito. A termo smm01100 referente a via metabólica foi representado 14 vezes nos alvos de miRNAs, sendo um valor acima da média no geral (Tabela 16). VI.3.3 Expressão gênica dos miRNAs de S. mansoni Dos 67 miRNAs identificados computacionalmente (Capítulo IV), 17 foram testados utilizando a técnica de qRT-PCR. No entanto, apenas os miRNAs maduros sma-mir-124-3p, sma-mir-125a, sma-mir-190-5p, sma-mir-3479-3p, sma-mir-36-3p, sma-mir-61 e sma-mir-83p (conservados) e sma-mir-new10-5p (não conservado) foram analisados devido a reprodutibilidade dos dados testados. Estes miRNAs foram avaliados no ciclo de S. mansoni, nas seguintes fases do parasito: cercária, esquistossômulos mecanicamente transformados de 3,5 horas (EMT-3,5) e 24 horas (EMT-24), vermes adultos fêmeas e machos. Estudos anteriores tem mostrado a expressão de vários miRNAs no gênero Schistosoma (Xue et al., 2008; Copeland et al., 2009; Huang et al., 2009; Hao et al., 2010; Wang et al., 2010; Cai et al., 2011; Simoes et al., 2011). Neste trabalho, em geral, foi observado uma tendência de expressão mais elevada nos estágios de cercária e esquistossômulo quando comparados com vermes adultos, fêmea e macho (Figura 50). 155

(185) miRNAs: novos controladores da expressão gênica em S. mansoni? Tabela 16: Associaçào entre os miRNAs identificados em S. mansoni, alvos preditos no genoma e alguns identificadores. miRNA Identificação do alvo sma-mir-71 sma-mir-new_10-3p sma-mir-2d-3p sma-mir-2e-3p sma-mir-2a-3p Smp_005670 rab11, putative Smp_010090 snf7-related Smp_011660.2 protein kinase Smp_020450 expressed protein Smp_023360.1 histidyl-tRNA synthetase, putative Smp_023360.2 histidyl-tRNA synthetase, putative Smp_028080 serine palmitoyltransferase 1 Smp_034120 synaptosomal associated protein, putative Smp_036400.1 NADH-ubiquinone oxidoreductase ashi subunit, putative Smp_044440 alcohol dehydrogenase, putative sma-mir-2a-3p sma-mir-2a-3p sma-mir-2a-5p sma-mir-new_2-5p sma-mir-2c-3p sma-mir-8-3p sma-mir-124-3p sma-mir-71 sma-mir-new_9-5p sma-mir-3492 sma-mir-71b-5p Smp_047450 snare protein ykt6, putative Smp_047660 ferritin, putative Smp_049600.4 DNAj (hsp40) homolog, subfamily C, member, putative Smp_055870 expressed protein Smp_055880.1 chmp1 (chromatin modifying protein) (charged multivesicular body protein), putative Smp_059360 pre-mRNA processing Identificação Identificação UniProt enzimática C4PYN8 C4PZQ2 C4Q0A0 C4Q2J2 C4Q3H7 NA NA 2.7.11.17 NA 6.1.1.21 Identificação do Grupo de ortólogos K07904 K12198 K04515 K14011 K01892 C4Q3H6 6.1.1.21 K01892 smm00970 C4Q4U4 2.3.1.50 K00654 smm00600, smm01100 C4Q6J5 NA K08508 smm04130 C4Q706 1.6.5.3 1.6.99.3 1.1.1.1 1.1.1.284 K03964 smm00190, smm01100 K00121 C4QA15 NA K08516 smm00010, smm00071, smm00350, smm00830, smm00980, smm00982, smm01100 smm04130 C4QA32 C4QAK6 1.16.3.1 NA K00522 K09523 smm00860 smm04141 Q26586 C4QCA0 NA NA K08515 K12197 smm04130 smm04144 C4QDD1 NA K12817 smm03040 C4Q967 156 Identificação da Via KEEG smm04144 smm04144 smm04310 smm04141 smm00970

(186) miRNAs: novos controladores da expressão gênica em S. mansoni? sma-mir-71b-5p sma-mir-71 sma-mir-2d-3p sma-mir-new_7-5p sma-mir-new_7-3p sma-mir-2a-3p sma-mir-10-5p sma-mir-3492 sma-mir-2a-5p sma-mir-new_15-3p sma-mir-71 sma-mir-2b-5p sma-mir-71b-5p sma-mir-71 sma-mir-2a-3p sma-mir-71 factor, putative Smp_064190 ocrl type II inositol 5phosphatase, putative Smp_064190 ocrl type II inositol 5phosphatase, putative Smp_077230 expressed protein Smp_097370 fructose-1,6bisphosphatase-related Smp_097370 fructose-1,6bisphosphatase-related Smp_105910 CREB-binding protein 1 (SmCBP1) Smp_106930.2 heat shock protein 70, putative Smp_120320.1 spliceosome-associated protein, putative Smp_120320.1 spliceosome-associated protein, putative Smp_125650 inositol polyphosphate multikinase, putative Smp_126260 protein phosphatase-2b, putative Smp_133390 restin-like Smp_137080 multidrug resistance protein 1, 2, 3 (p glycoprotein 1, 2, 3), putative Smp_137080 multidrug resistance protein 1, 2, 3 (p glycoprotein 1, 2, 3), putative Smp_141630.1 splicing factor 3b, subunit 1-related Smp_151420 phospholipase D C1LZH8 3.1.3.36 K01099 C1LZH8 3.1.3.36 K01099 C4QI45 C4QN25 NA 3.1.3.11 K08495 K03841 C4QN25 3.1.3.11 K03841 C4QQ60 2.3.1.48 K04498 C4QQH4 NA K03283 C4QU54 NA K12825 smm00562, smm01100, smm04070 smm00562, smm01100, smm04070 smm04130 smm00010, smm00030, smm00051, smm01100 smm00010, smm00030, smm00051, smm01100 smm04310, smm04330, smm04350, smm04630 smm03040, smm04141, smm04144 smm03040 C4QU54 NA K12825 smm03040 C4PYS1 2.7.1.151 K00328 smm00562 C4PZ44 3.1.3.16 K04348 smm04310, smm04650 C4Q2S0 C4Q4P8 NA NA K05293 K05658 smm00563, smm01100 smm02010 C4Q4P8 NA K05658 smm02010 C4Q6X8 NA K12828 smm03040 C4QC25 3.1.4.4 K01115 smm00564, smm00565, smm01100, smm04144 157

(187) miRNAs: novos controladores da expressão gênica em S. mansoni? sma-mir-124-5p Smp_159670 synaptojanin, putative C4QFY3 3.1.3.36 K01099 sma-mir-36-3p sma-mir-250 sma-mir-2e-3p Smp_167500 ap endonuclease, putative Smp_167500 ap endonuclease, putative Smp_167690 ubiquitin-protein ligase, putative Smp_169430 partition defective complex protein Smp_172660 mevalonate 5 pyrophosphate decarboxylase Smp_177040 expressed protein Smp_177080 alpha-1,3mannosyltransferase Smp_177080 alpha-1,3mannosyltransferase C4QJQ7 C4QJQ7 C4QJU1 4.2.99.18 4.2.99.18 6.3.2.19 K10772 K10772 K10592 smm00562, smm01100, smm04070 smm03410 smm03410 smm04120 C4QKM7 NA K04237 smm04080, smm04144 C4QLX1 4.1.1.33 K01597 smm00900, smm01100 C4QNK8 C4QNL8 2.4.1.2.4.1.2.4.1.132 2.4.1.2.4.1.132 K07542 K03843 smm00563, smm01100 smm00510, smm01100 K03843 smm00510, smm01100 sma-mir-190-5p sma-mir-new_11-3p sma-mir-new_15-3p sma-mir-71b-5p sma-mir-71 C4QNL8 158

(188) miRNAs: novos controladores da expressão gênica em S. mansoni? A utilização de outras formas de análise da expressão gênica de miRNAs tem sido utilizada no gênero Schistosoma (Hao et al., 2010; Wang et al., 2010; Cai et al., 2011; Simoes et al., 2011). Em S. japonicum, sequenciamento de nova geração tem sido usado para avaliação da expressão gênica de miRNAs em diferentes fases do ciclo do parasito (Hao et al., 2010; Wang et al., 2010; Cai et al., 2011). Um estudo comparativo, realizado em S. japonicum, mostrou que as principais metodologias utilizadas para expressão de miRNAs (sequenciamento de nova geração, Northern blot e qRT-PCR) apresentaram valores bem similares em relação ao nível de miRNAs (Cai et al., 2011). Assim, neste trabalho, a técnica de qRT-PCR foi escolhida para identificação de miRNAs maduros em diferentes fases de S. mansoni devido sua alta sensibilidade utilizando baixas quantidades de RNA. Específicamente a expressão do miRNA sma-mir-12a5 mostrou-se ser estágioespecífico. A figura 50 mostrou uma expressão deste gene exclusivamente nas fases de vermes adultos (fêmea e macho) e não expressão em cercária e esquistossômulos de 3,5 horas e 24 horas (Figura 50). Simões (2011) utilizando Northern blot, mostrou que o gene sma-mir125a altamente expresso em vermes adultos quando comparado com esquistossômulos de 7 dias corroborando com os resultados apresentados neste trabalho (Figura 50). O mesmo foi encontrado para o gene sja-mir-125, ortólogo de sma-mir-125a, que apresentou maior expressão na fase de vermes adultos em relação a esquistossômulos. Huang (2009) também sequenciou outros miRNAs utilizando sequenciamento de nova geração nas fases de esquistossômulos e vermes adultos no parasito S. japonicum. Outro gene avaliado, sja-mir124, demonstrou uma expressão maior em esquistossômulos comparada com vermes adultos (Huang et al., 2009). A mesma tendência de expressão foi observada no ortólogo sma-mir124-3p, que apresentou uma expressão quase 10 vezes maior em esquistossômulos de 3,5 horas e 24 horas comparada com os estágios de vermes adultos, fêmeas e machos (Figura 50). VI.3.3.1 miRNAs sexo-específicos A expressão sexo-específica de alguns miRNAs tem sido mostrada em diversos organismos como mamíferos e também S. japonicum (Zhang et al., 2007; Mishima et al., 2008; Cai et al., 2011). Em mamíferos tem sido mostrado que a expressão gênica regulada de alguns miRNAs está totalmente correlacionada com a maturação sexual do indivíduo (Zhang et al., 2007; Mishima et al., 2008). Mishima (2008) demonstrou em camundongos que aproximadamente 80% dos miRNAs altamente expressos em células do sistema reprodutor masculino tem sido localizados no cromossomo X. Cai (2011) mostrou uma tendência na 159

(189) miRNAs: novos controladores da expressão gênica em S. mansoni? expressão gênica de alguns miRNAs nas diferentes fases de S. japonicum: vermes adultos fêmeas e machos. Foi mostrado que os miRNAs maduros sja-miR-7-5p, sja-miR-61, sja-miR219-5p, sja-miR-125a, sja-miR-125b, sja-miR-124-3p e sja-miR-1 apresentaram uma dominância na expressão em vermes adultos macho, enquanto os miRNAs maduros sjabantam, sja-miR-71b-5p, sja-miR-3479-5p e sja-Novel-23-5p apresentaram dominância em parasitos fêmea (Cai et al., 2011). Neste trabalho, a expressão dos miRNAs maduros também foi avaliada em sexos específicos. Foi observado a mesma tendência de expressão em relação aos miRNAs avaliados sma-miR-61, sma-miR-125a e sma-miR-124-3p corroborando com os resultados apresentados por Cai, 2011. Estes genes mostraram um aumento de 3 vezes na expressão em vermes adultos machos em relação as fêmeas. A mesma tendência foi observada para as expressões gênicas dos ortólogos sja-miR-61, sja-miR-125a e sja-miR-124-3p corroborando com os resultados anteriores (Cai et al., 2011). O miRNA com a maior diferença observada entre as expressões foi o miRNA sma-mir-61 (Figura 50). O mesmo foi demonstrado por Cai (2011) que mostrou expressão 3 vezes maior de sja-mir-61em vermes machos comparado com vermes fêmeas. Assim, o estudo da expressão gênica de miRNAs, em diferentes fases do parasito, abre perspectivas para a investigação da influência destes genes em seus alvos, sugerindo que estas moléculas podem alterar, não apenas pontualmente o funcionamento celular, mas também a homeostase do organismo como um todo. Além disso, a descoberta de genes expressos gênero-específicos podem auxiliar no estudo das interações parasito-parasito e parasito-hospedeiro sugerindo uma potente ferramenta para busca de novos medicamentos e formas de diagnóstico mais precisas. 160

(190) miRNAs: novos controladores da expressão gênica em S. mansoni? Figura 50: Expressão gênica dos miRNAs, conservados e não conservados, identificados no genoma de S. mansoni. Os genes (a) sma-mir-124-3p, (b) sma-mir-8-3p, (c) sma-mir-363p, (d) sma-mir-61, (e) sma-mir-125a, (f) sma-mir-190-5p, (g) sma-mir-3479-3pe (conservados) e (h) sma-mir-new10-5p (não conservado) foram avaliados quanto a expressão gênica por qRT-PCR nas fases de cercária, esquistossômulo de 3,5 horas e 24 horas e vermes adultos fêmeas e machos. Como normalizador (gene constitutivo) foi utilizado o gene da U6 e a expressão gênica relativa foi determinada pelo método do 2-ΔCt. A análise estatística foi 161

(191) miRNAs: novos controladores da expressão gênica em S. mansoni? realizada utilizando o teste de Tukey com p<0,05 no programa GraphPad Prism. As diferenças estatísticas entre os estágios foram determinadas pelos sinais: * diferente de cercária, ** diferente de EMT-3,5 horas, *** diferente de EMT-24 horas, # diferente de vermes fêmea. VI.3.4 Alvos evolutivamente conservados Neste trabalho a busca por alvos conservados foi realizada para os miRNAs validados sma-mir-124-3p, sma-mir-125a, sma-mir-190-5p, sma-mir-3479-3p, sma-mir-36-3p, smamir-61, sma-mir-8-3p e sma-mir-new10-5p. Esta iniciativa teve a finalidade de obter informações biológicas relevantes perante a flutuação na expressão gênica dos miRNAs. A estratégia de busca de alvos evolutivamente conservados (região 3`UTR) tende a aumentar a acurácia do método sendo realizada por alguns programas de predição de alvos de miRNAs. O programa TargetScan tem usado como critério a presença de 3`UTRs evolutivamente conservadas e complementares a extremidade 5` dos miRNAs (principalmente a região seed e seus nucleotídeos vizinhos), O posicionamento dos nucleotídeos vizinhos tem influência na formação de um pareamento mais ou menos preciso originando pareamentos dos tipos: 7merm8, 7mer-1A e 8 mer. Estes 3 tipos estão relacionados com os pareamentos envolvendo os miRNAs e suas respectivas 3`UTR. Os pareamentos 7mer-m8 apresentam 100% de complementaridade no sítio de ligação da região 5’ seed do miRNA (2-8 nucleotídeos) e a região 3`UTR do gene alvo. Os pareamentos 7mer-1A apresentam 100% de complementaridade no sítio de ligação da região 5’ seed (2-7 nucleotídeos) sendo o primeiro nucleotídeo “U” do miRNA e a região 3`UTR do gene alvo. Os pareamentos 8mer apresentam 100% de complementaridade no sítio de ligação da região 5’ seed (2-8 nucleotídeos) sendo o primeiro nucleotídeo “U” do miRNA e a região 3`UTR do gene alvo. A comparação dos possíveis alvos evolutivamente conservados presentes em S. mansoni e S. japonicum, foi realizada aumentando a flexibilidade da predição (delta G menor ou igual a -18kcal/mol). Este procedimento aumentou o número de alvos para 904 mantendo os pares miRNA (seed)/3`UTR com 100% de complementaridade. Esta estratégia não levou em consideração a possibilidade 7mer-1A que apresenta menor pontuação de pareamento, sendo menos estringente que os critérios 8mer e 7mer-m8. Assim, neste trabalho, mantiveram-se apenas as opções 8mer e 7mer-m8. Estas estratégias aumentaram a especificidade da predição dos alvos de miRNAs buscando um significado biológico mais preciso para estas moléculas. 162

(192) miRNAs: novos controladores da expressão gênica em S. mansoni? Os alvos que apresentaram similaridade entre as espécies S. mansoni e S. japonicum foram selecionados para análise. Para tal procedimento, as regiões 3`UTRs dos correspondentes genes alvos de miRNA de S. mansoni foram comparadas com o banco de dados genômico de S. japonicum. Vale enfatizar que as sequências 3’UTRs foram averiguadas quanto a localização no genoma em comparação com a posição do respectivo gene ortólogo em S. japonicum. Isto foi necessário já que o genoma do parasito S. japonicum não apresenta anotação quanto à localização das regiões 3`UTRs dos genes preditos. Foram separados para as análises os alvos dos miRNAs validados sma-mir-124-3p, sma-mir-125a, sma-mir-190-5p, sma-mir-3479-3p, sma-mir-36-3p, sma-mir-61, sma-mir-8-3p e sma-mirnew10-5p. Após a recuperação das 3`UTRs do genoma de S. japonicum estas foram analisadas quanto a presença dos sítios de pareamento do par miRNA/3`UTR. Somente as sequências com 100% de identidade entre a 3`UTR e a região seed foram aceitas. A tabela 17 apresenta os prováveis genes alvos com a possível região de regulação em ambos parasitos, S. mansoni e S. japonicum. Os prováveis miRNAs sma-mir-3479-3p e sma-mir-new10-5p não apresentaram alvos conservados com parâmetros suficientemente confiáveis. 163

(193) miRNAs: novos controladores da expressão gênica em S. mansoni? Tabela 17: Alvos preditos em S. mansoni e S. japonicum usando conservação evolutiva do pareamento miRNA/3`UTR. miRNA S. mansoni Gene Alvo em S. mansoni sma-mir-124-3p Smp_177060 synoviolin, putative Smp_173970 DEAD box ATP-dependent RNA helicase, putative Smp_153830 neurobeachin, putative sma-mir-36-3p sma-mir-190-5p Posição do sítio de pareamento na 3`UTR 160..179 miRNA S. japonicum Gene Alvo em S. japonicum Supercontig sja-mir-124-3p SJC S000485 1..20 sja-mir-36-3p Sjp_0051390 Protein TRC8 homolog, putative Sjp_0036950 me31B adenosinetriphosphatase, putative 14..36 sja-mir-190-5p Sjp_0003260 Protein neurobeachin (Protein rugose) (Akinase anchor protein 550) (AKAP 550) (dAKAP550), putative Sjp_0103760 Innexin unc-9 (Uncoordinated protein 9), putative Sjp_0114730 Zinc finger protein 544, putative Sjp_0076950 Programmed cell death protein 4 (Nuclear antigen H731-like) (Neoplastic transformation inhibitor protein) (Protein 197/15a), putative Sjp_0076950 Programmed cell death protein 4 (Nuclear antigen H731-like) (Neoplastic transformation inhibitor protein) (Protein 197/15a), putative Sjp_0076950 Programmed cell death protein 4 (Nuclear antigen H731-like) (Neoplastic transformation inhibitor protein) (Protein 197/15a), putative Sjp_0022300 gro; groucho; groucho, putative Sjp_0039700 AN1-type zinc finger protein 6 (Zinc finger A20 domain-containing protein 3), putative sma-mir-125a Smp_066900 innexin, putative 147..168 sja-mir-125a sma-mir-124-3p Smp_074040 zinc finger protein, putative Smp_072110.1 programmed cell death, putative 201..223 sja-mir-124-3p 16..41 sja-mir-36-3p sma-mir-36-3p Smp_072110.2 programmed cell death, putative 16..41 sja-mir-36-3p sma-mir-36-3p Smp_072110.3 programmed cell death, putative 16..41 sja-mir-36-3p sma-mir-61 Smp_150080 transducin-like enhancer protein 1 Smp_072720 zinc finger protein, putative 194..217 sja-mir-61 165..189 sja-mir-8-3p sma-mir-36-3p sma-mir-8-3p 164 Posição do gene genoma 144682 159998 14172 15501 Posição da 3`UTR no genoma 159999 – 160190 15502 – 15643 Fita SJC S000008 50657 138729 138730139134 + SJC S004154 4603 29614 22203 – 22371(-) - SJC S008397 21 - 1038 1039-1872 + SJC S001294 115588 122697 115433 115580 + SJC S001295 115589 122697 115434 115580 + SJC S001296 115590 122697 115435 115580 + SJC S000123 255322 286413 170352 – 173918 () 281177 – 281490 169601170351 (-) + SJC S000262 SJC S000300 + + -

(194) miRNAs: novos controladores da expressão gênica em S. mansoni? VI.3.5 Expressão gênica de alvos conservados de S. mansoni Neste trabalho, as expressões dos genes alvos inexina e sinoviolina em cercária e vermes adultos foram correlacionadas com as expressões de seus respectivos controladores miRNAs maduros. As figuras 51 mostram as expressões dos alvos nos estágios cercária e vermes adultos. A expressão alta de um miRNA em um determinado estágio sugere uma provável controle negativo de seu gene alvo. Ambos os miRNAs, sma-mir-124-3p e sma-mir125a, mostraram possível atuação em seus respectivos genes alvos, sendo o miRNA sma-mir125a mais acentuado. A alta expressão de sma-mir-125a em vermes machos e fêmeas provavelmente resultou em uma regulação negativa do alvo inexina neste estágio apresentando uma baixa expressão em vermes adultos. Figura 51: Expressão gênica relativa dos genes alvos Sinoviolina e Inexina. As expressões relativas dos genes sinoviolina e inexina foram analisadas utilizando Real Time PCR nas fases cercária e vermes adultos. Como normalizador (gene constitutivo) foi utilizado o gene da α-tubulina e a expressão gênica relativa foi determinada pelo método do 2-ΔCt. A análise estatística foi realizada utilizando o teste de Tukey com P<0,05 no programa GraphPad Prism. As diferenças estatísticas entre os estágios foram determinadas pelos sinais: * diferente de cercária. VI.3.5.1 Smp_066900 inexina (sma-mir-125a) Inexinas são proteínas pertencentes ao grupo de canais especializados, chamados junções tipo GAP, que permitem a comunicação célula-célula nos metazoários. Em vertebrados esta função tem sido desempenhada por uma família de genes chamada conexinas, e em invertebrados uma grupo de proteínas ortólogas chamadas inexinas (Phelan, 2005; Von Stetina and Orr-Weaver, 2011). Em S. mansoni tem sido descritas vários 165

(195) miRNAs: novos controladores da expressão gênica em S. mansoni? homólogos do gene inexina de invertebrados sendo uma das quais o gene Smp_066900. Neste trabalho, o gene inexina Smp_066900 mostrou em sua região 3`UTR sítios de ligação para o miRNA maduro sma-mir-125a. Além disso, este sitio de ligação foi consistentemente conservado na região 3`UTR do gene inexina ortólogo encontrado no genoma de S. japonicum aumentando a confiabilidade da predição. Foi mostrado também que a expressão do miRNA sma-mir-125a foi elevada principalmente em vermes adultos sendo quase nula em cercárias e esquistossômulos (diferença de mais de 20 vezes) (Figura 50). Parker-Manuel (2011) mostrou a presença de 3 transcritos expressos de inexinas após a infecção do parasito definitivo na fase de esquistossômulo de 3 dias. Este resultado enfatizou a importância das interações célula-célula em estágios posteriores a infecção no hospedeiro definitivo (ParkerManuel et al., 2011). A baixa expressão do gene sma-mir-125a verificada nos estágios de cercária e esquistossômulo corroboram com as conclusões obtidas anteriormente, sugerindo que baixa expressão deste miRNA provavelmente está correlacionada com a alta expressão do seu alvo direto inexina principalmente em estágios como cercária e esquistossômulos fomentando sua ativa importância nestas fases pré e pós infecção. Em C. elegans tem sido mostrado que as inexinas, específicamente, INX-14 and INX22, são requeridas em linhagens germinais de fêmeas, com a finalidade de manter os oócitos na fase de meiótica prófase I na ausência de esperma (Whitten and Miller, 2007). Além disso, estudos anteriores em D. melanogaster têm mostrado que as inexinas promovem a interconexão de células do ovário e células somáticas sendo responsáveis pela comunicação na oogênese (Bohrmann and Zimmermann, 2008). Análise de microarranjos de tecidos micro dissecados de vermes fêmeas em S. japonicum tem mostrado alta expressão de inexinas em células vitelínicas, demonstrando sua importância para esta etapa de fecundação (Gobert et al., 2009a). Neste trabalho, foi observado que o miRNA sma-mir-125a está mais expresso em vermes machos comparado com fêmeas. Este dado corrobora com a importância do gene inexina nos vermes fêmeas, exigindo assim, uma baixa expressão de seu repressor direto sma-mir-125a. Assim, a diferença na expressão gênica deste miRNA, nos diferentes sexos do parasito, refletirá no repertório final de genes alvos que estes controlam, influenciando por exemplo a maturação sexual gênero-específica. VI.3.5.2 Smp_177060 sinoviolina (sma-mir-124-3p) Sinoviolina, também conhecida como HRD1, é uma E3 ligase da via de ubiquina proteassoma localizada no retículo endoplasmático com participação no sistema de 166

(196) miRNAs: novos controladores da expressão gênica em S. mansoni? degradação associado ao retículo (Tsuchimochi et al., 2005; Hasegawa et al., 2010). Estudos anteriores têm mostrado sua participação em diversos processos celulares como embriogênese, hipóxia, e apoptose (Yagishita et al., 2005; Yamasaki et al., 2007; Wouters and Koritzinsky, 2008). Yagishita (2005) mostrou que a ausência deste gene nas fases embrionárias interrompe o desenvolvimento embrionário em ratos. Tsuchimochi (2005) mostrou que esta proteína tem a função de manter uma homeostase celular modulando a resposta a apoptose e eliminando proteínas com conformações incorretas. Em C. elegans, tem sido demonstrado, a participação deste gene impedindo a formação de proteínas mutantes como a lin-12. Tem sido descrito que esta proteína está envolvida na maturação vulval do nematódeo (Choi et al., 2010). Neste trabalho, o gene que codifica a proteína sinoviolina (Smp_177060) foi identificado como alvo do miRNA sma-mir-124-3p. Foi mostrado que este miRNA está mais expresso em cercária com um discreto decréscimo em esquistossômulo e um acentuado decréscimo em vermes adultos. Tem sido demonstrado que o desenvolvimento embrionário de S. mansoni ocorre inicialmente no sistema reprodutivo da fêmea, ou seja, inicia-se o processo de embriogênese do parasito antes dos ovos serem liberados na corrente sanguínea (Jurberg et al., 2009). Devido ao fato deste mRNA alvo, sinoviolina, participar de processos envolvidos com embriogênese, maturação sexual e resposta a hipóxia espera-se uma baixa expressão deste gene em cercárias e alta expressão, principalmente, em vermes adultos. Esta afirmação corrobora com resultados encontrados neste trabalho, onde uma elevada expressão do miRNA modulador negativo, sma-mir-124-3p, aponta para uma provável redução da expressão de sinoviolina em cercária. No entanto não foi visualizado uma diminuição significativa da expressão do mRNA na Figura 51, necessitando de uma análise em mais estágios e uma análise da expressão ao nível protéico. A diminuição da expressão do miRNA sma-mir-124-3p, em esquistossômulos, pode estar relacionada com uma provável atuação de sinoviolina em processos de manutenção da homeostase celular desestabilizada pela hipóxia acometida pelo parasito nesta fase. Uma drástica diminuição da expressão do miRNA em vermes adultos, sustenta a hipótese de uma provável atuação do alvo sinoviolina neste estágio permitindo-o participar em processos essenciais de maturação sexual e embriogênese no parasito. 167

(197) miRNAs: novos controladores da expressão gênica em S. mansoni? VI.3.6 Controle da expressão gênica ao nível pós-transcricional em S. mansoni A figura 52 resume os principais resultados obtidos neste trabalho. A expressão dos miRNAs e dos genes da maquinaria de silenciamento gênico mediada por miRNAs mostrouse significantemente maior em estágios de cercária e esquistossômulo jovens quando comparados com vermes adultos. Trabalhos recentes têm mostrado que o perfil de transcritos e a atividade transcricional no parasito S. mansoni modificam significantemente em diferentes estágios (Fitzpatrick et al., 2009). Entre o estágio de vida livre cercária e o estágio intra-hospedeiro definitivo (vermes adultos) existem muitas mudanças morfológicas e de composição celular refletidas pela modificação da expressão gênica (Gobert et al., 2009b). No estágio de cercária, o nível transcricional tem se mostrado mais baixo quando comparado com os outros estágios, ou seja, poucos genes são unicamente transcritos ou poucos são enriquecidos nesta fase. No entanto, neste estágio, genes envolvidos com a função mitocondrial produzindo energia para a procura do hospedeiro definitivo e aqueles envolvidos na migração do verme na fase de esquistossômulos têm mostrado uma expressão mais relevante (Parker-Manuel et al., 2011). Muitas proteínas e mRNAs de cercária tem sido transcritos e traduzidos em fases embrionárias de esporocisto-mãe evitando um gasto de energia excedente (Parker-Manuel et al., 2011). Este fato pode ser confirmado pela grande correlação entre transcritos das duas fases em níveis quantitativos como mostrado em espécies do gênero Schistosoma (Gobert et al., 2009b). Na fase de transformação, cercária/esquistossômulos, a baixa transcrição de novo de genes ocorre para propiciar uma simples rediferenciação de células e tecidos existentes e não para uma embriogênese propriamente dita (Parker-Manuel et al., 2011). Para tal processo, Blanton e Licate (1992), sugeriram uma regulação pós-transcricional nesta fase de transição evitando uma expressão real de proteínas provenientes dos mRNAs (Blanton and Licate, 1992). 168

(198) miRNAs: novos controladores da expressão gênica em S. mansoni? Figura 52: Controle da expressão gênica em S. mansoni. A contribuição dos mecanismos pós-transcricionais, como silenciamento gênico mediado por miRNAs, tem sido mais efetiva no controle da expressão gênica em estágios larvais do parasito S. mansoni. Os retângulos vermelhos tracejados representam as relativas expressões dos genes da via de miRNAs e de seus efetores. Por outro lado mecanismos de controle transcricional tem sido também encontrados em S. mansoni auxiliando no controle da expressão gênica no parasito. Os principais mecanismos de controle transcricional estão relacionados com a estrutura da cromatina. Processos como modificação de histonas (acetilação, metilação e deacetilação) e metilação de DNA desempenham um papel essencial no empacotamento de cromatina e consequentemente no controle da expressão gênica a nível transcricional (Berger, 2007). Recentemente, vários mecanismos de controle transcricional têm sido mostrados ativos em vermes adultos de S. mansoni, estágio no qual tem apresentado maior atividade metabólica e altos níveis de divisão celular (principalmente em fêmeas para produção de ovos)(Pierce et al., 2011). Tais moléculas, ativas em vermes adultos, têm sido usadas para o estudo de alvos de drogas para o controle da parasitose visto sua importância vital no controle transcricional de genes do parasito (Pierce et al., 2011). A tendência de expressão elevada de moléculas envolvidas no controle pós transcricional nos estágios larvais de S. mansoni corroboram com a expressão tardia de alguns transcritos, gerados em esporocistos, e expressos em estágios posteriores como cercária e esquistossômulos. Assim, baseados em dados deste trabalhos, sugere-se que os mecanismos de regulação da expressão gênica ao nível pós transcricional, relacionados como 169

(199) miRNAs: novos controladores da expressão gênica em S. mansoni? os miRNAs, tem estado mais ativos em estágios larvais do parasito, como cercária e esquistossômulos, enquanto as vias de regulação ao nível transcricional estão mais ativas em vermes adultos. O entendimento dos processos de controle da expressão gênica ao nível transcricional e pós-transcricional, no desenvolvimento e diferenciação do parasito, são essenciais para o avanço do conhecimento de sua biologia e o discernimento de seu modo de evolução dentre os seres eucariotos possibilitando o desenvolvimento de novas drogas, vacinas e o controle da parasitose. Parte dos resultados obtidos neste trabalho fazem parte do manuscrito recentemente publicado na Revista Genomics: “Genome-wide identification of novel microRNAs and their target genes in the human parasite Schistosoma mansoni”. A outra parte, envolvendo a expressão dos miRNAs e seus prováveis alvos, está em fase de escrita, e brevemente será submetido. 170

(200) Conclusões CAPÍTULO VII Conclusões 171

(201) Conclusões Os principais resultados deste trabalho permitiram as seguintes conclusões: - 13 genes e 18 transcritos fazem parte da maquinaria de biogênese de microRNA no parasito S. mansoni; - As proteínas preditas SmExportin5.1, SmExportin5.2, SmExportin1.1, SmExportin1.2, SmDrosha1, SmDrosha2, SmAgo1, SmPartner-Dicer, SmPartner-Drosha, SmFmr1.1, SmFmr1.2, SmFmr1.3, SmFmr1.4 e SmTudor-SN mostraram-se evolutivamente conservadas com padrões característicos de domínios conservados em suas estruturas primárias; - Os genes SmExportin5.1, SmExportin5.2, SmExportin1.1, SmExportin1.2, SmDrosha1, SmDrosha2, SmAgo1, SmPartner-Dicer, SmPartner-Drosha, SmFmr1.1, SmFmr1.2, SmFmr1.3, SmFmr1.4 e SmTudor-SN mostraram-se diferencialmente expressos nos estágios de esquistossômulos mecanicamente transformados de 3,5 horas, 24 horas, 72 horas, 5 dias, 7 dias, cercárias e vermes adulto; - 67 novos miRNAs, 32 não conservados e 35 conservados foram identificados em S. mansoni; - Os miRNAs conservados apresentaram duplicações gênicas, formações de clusteres (mir71/2) e presença de miRNAs sexo-específicoss; - 389 genes alvos foram preditos para os 67 miRNAs maduros; - Alguns miRNAs mostraram expressão gênica estágio-específica sendo o sma-mir125a expresso apenas em vermes adultos, sma-new10-5p em cercárias e sma-mir-124 e sma-mir-36 -3p em cercárias e em esquistossômulos jovens; - Alguns miRNAs mostram expressão sexo-específica como sma-mir-125a, sma-mir-61 e sma-mir-124. - Uma correlação positiva foi encontrada entre alta expressão de miRNA e baixa expressão do alvo, exemplificados pela regulação do gene da inexina (Smp_066900 inexina) pelo smamir-125a e do gene da sinoviolina (Smp_177060) por sma-mir-124-3p; - Os níveis de expressão gênica, tanto dos miRNAs quanto dos genes envolvidos na maquinaria de silenciamento mediada por miRNAs, foram elevados em cercárias e esquistossômulos jovens comparados a vermes adultos; Em conjunto, os resultados obtidos sugerem que a regulação pós-transcricional mediada por miRNAs regula o proteoma do parasito, principalmente nas fases cercária e esquistossômulos, contribuindo para sua efetiva instalação no hospedeiro mamífero. 172

(202) Referências Bibliográficas CAPÍTULO VIII REFERÊNCIAS BIBLIOGRÁFICAS 173

(203) Referências Bibliográficas VIII. REFERÊNCIAS BIBLIOGRÁFICAS Abbott, A.L., Alvarez-Saavedra, E., Miska, E.A., Lau, N.C., Bartel, D.P., Horvitz, H.R. and Ambros, V. The let-7 MicroRNA family members mir-48, mir-84, and mir-241 function together to regulate developmental timing in Caenorhabditis elegans. Dev Cell 9 (2005), pp. 403-14. Altuvia, Y., Landgraf, P., Lithwick, G., Elefant, N., Pfeffer, S., Aravin, A., Brownstein, M.J., Tuschl, T. and Margalit, H. Clustering and conservation patterns of human microRNAs. Nucleic Acids Res 33 (2005), pp. 2697-706. Ambros, V. Control of developmental timing in Caenorhabditis elegans. Curr Opin Genet Dev 10 (2000), pp. 428-33. Ambros, V. MicroRNA pathways in flies and worms: growth, death, fat, stress, and timing. Cell 113 (2003), pp. 673-6. Arnold, K., Bordoli, L., Kopp, J. and Schwede, T. The SWISS-MODEL workspace: a webbased environment for protein structure homology modelling. Bioinformatics 22 (2006), pp. 195-201. Artzi, S., Kiezun, A. and Shomron, N. miRNAminer: a tool for homologous microRNA gene search. BMC Bioinformatics 9 (2008), p. 39. Axtell, M.J. Evolution of microRNAs and their targets: are all microRNAs biologically relevant? Biochim Biophys Acta 1779 (2008), pp. 725-34. Azuma-Mukai, A., Oguri, H., Mituyama, T., Qian, Z.R., Asai, K., Siomi, H. and Siomi, M.C. Characterization of endogenous human Argonautes and their miRNA partners in RNA silencing. Proc Natl Acad Sci U S A 105 (2008), pp. 7964-9. Bartel, D.P. MicroRNAs: target recognition and regulatory functions. Cell 136 (2009), pp. 215-33. Basch, P.F. Cultivation of Schistosoma mansoni in vitro. I. Establishment of cultures from cercariae and development until pairing. J Parasitol 67 (1981), pp. 179-85. Bassell, G.J. and Warren, S.T. Fragile X syndrome: loss of local mRNA regulation alters synaptic development and function. Neuron 60 (2008), pp. 201-14. Baum, B. and Craig, G. RNAi in a postmodern, postgenomic era. Oncogene 23 (2004), pp. 8336-9. Bentwich, I., Avniel, A., Karov, Y., Aharonov, R., Gilad, S., Barad, O., Barzilai, A., Einat, P., Einav, U., Meiri, E., Sharon, E., Spector, Y. and Bentwich, Z. Identification of 174

(204) Referências Bibliográficas hundreds of conserved and nonconserved human microRNAs. Nat Genet 37 (2005), pp. 766-70. Berezikov, E. Evolution of microRNA diversity and regulation in animals. Nat Rev Genet 12 (2011), pp. 846-60. Berezikov, E., Cuppen, E. and Plasterk, R.H. Approaches to microRNA discovery. Nat Genet 38 Suppl (2006), pp. S2-7. Berezikov, E., Guryev, V., van de Belt, J., Wienholds, E., Plasterk, R.H. and Cuppen, E. Phylogenetic shadowing and computational identification of human microRNA genes. Cell 120 (2005), pp. 21-4. Berger, S.L. The complex language of chromatin regulation during transcription. Nature 447 (2007), pp. 407-12. Berriman, M., Haas, B.J., LoVerde, P.T., Wilson, R.A., Dillon, G.P., Cerqueira, G.C., Mashiyama, S.T., Al-Lazikani, B., Andrade, L.F., Ashton, P.D., Aslett, M.A., Bartholomeu, D.C., Blandin, G., Caffrey, C.R., Coghlan, A., Coulson, R., Day, T.A., Delcher, A., DeMarco, R., Djikeng, A., Eyre, T., Gamble, J.A., Ghedin, E., Gu, Y., Hertz-Fowler, C., Hirai, H., Hirai, Y., Houston, R., Ivens, A., Johnston, D.A., Lacerda, D., Macedo, C.D., McVeigh, P., Ning, Z., Oliveira, G., Overington, J.P., Parkhill, J., Pertea, M., Pierce, R.J., Protasio, A.V., Quail, M.A., Rajandream, M.A., Rogers, J., Sajid, M., Salzberg, S.L., Stanke, M., Tivey, A.R., White, O., Williams, D.L., Wortman, J., Wu, W., Zamanian, M., Zerlotini, A., Fraser-Liggett, C.M., Barrell, B.G. and El-Sayed, N.M. The genome of the blood fluke Schistosoma mansoni. Nature 460 (2009), pp. 352-8. Blanton, R., Loula, E.C. and Parker, J. Two heat-induced proteins are associated with transformation of Schistosoma mansoni cercariae to schistosomula. Proc Natl Acad Sci U S A 84 (1987), pp. 9011-4. Blanton, R.E. and Licate, L.S. Developmental regulation of protein synthesis in schistosomes. Mol Biochem Parasitol 51 (1992), pp. 201-8. Bohrmann, J. and Zimmermann, J. Gap junctions in the ovary of Drosophila melanogaster: localization of innexins 1, 2, 3 and 4 and evidence for intercellular communication via innexin-2 containing channels. BMC Dev Biol 8 (2008), p. 111. Brindley, P.J. and Pearce, E.J. Genetic manipulation of schistosomes. Int J Parasitol 37 (2007), pp. 465-73. Burroughs, A.M., Kawano, M., Ando, Y., Daub, C.O. and Hayashizaki, Y. pre-miRNA profiles obtained through application of locked nucleic acids and deep sequencing 175

(205) Referências Bibliográficas reveals complex 5'/3' arm variation including concomitant cleavage and polyuridylation patterns. Nucleic Acids Res (2011). Bussing, I., Yang, J.S., Lai, E.C. and Grosshans, H. The nuclear export receptor XPO-1 supports primary miRNA processing in C. elegans and Drosophila. EMBO J 29 (2010), pp. 1830-9. Cai, P., Hou, N., Piao, X., Liu, S., Liu, H., Yang, F., Wang, J., Jin, Q., Wang, H. and Chen, Q. Profiles of small non-coding RNAs in Schistosoma japonicum during development. PLoS Negl Trop Dis 5 (2011), p. e1256. Caldas, I.R., Campi-Azevedo, A.C., Oliveira, L.F., Silveira, A.M., Oliveira, R.C. and Gazzinelli, G. Human schistosomiasis mansoni: immune responses during acute and chronic phases of the infection. Acta Trop 108 (2008), pp. 109-17. Callebaut, I., Labesse, G., Durand, P., Poupon, A., Canard, L., Chomilier, J., Henrissat, B. and Mornon, J.P. Deciphering protein sequence information through hydrophobic cluster analysis (HCA): current status and perspectives. Cell Mol Life Sci 53 (1997), pp. 621-45. Callebaut, I. and Mornon, J.P. The human EBNA-2 coactivator p100: multidomain organization and relationship to the staphylococcal nuclease fold and to the tudor protein involved in Drosophila melanogaster development. Biochem J 321 ( Pt 1) (1997), pp. 125-32. Campo-Paysaa, F., Semon, M., Cameron, R.A., Peterson, K.J. and Schubert, M. microRNA complements in deuterostomes: origin and evolution of microRNAs. Evol Dev 13 (2011), pp. 15-27. Castanotto, D., Lingeman, R., Riggs, A.D. and Rossi, J.J. CRM1 mediates nuclearcytoplasmic shuttling of mature microRNAs. Proc Natl Acad Sci U S A 106 (2009), pp. 21655-9. Cheever, A. and Ceman, S. Translation regulation of mRNAs by the fragile X family of proteins through the microRNA pathway. RNA Biol 6 (2009), pp. 175-8. Chen, C., Tan, R., Wong, L., Fekete, R. and Halsey, J. Quantitation of microRNAs by realtime RT-qPCR. Methods Mol Biol 687 (2011), pp. 113-34. Chen, J., Yang, Y., Guo, S., Peng, J., Liu, Z., Li, J., Lin, J. and Cheng, G. Molecular cloning and expression profiles of Argonaute proteins in Schistosoma japonicum. Parasitol Res 107 (2010), pp. 889-99. Chen, N. Using RepeatMasker to identify repetitive elements in genomic sequences. Curr Protoc Bioinformatics Chapter 4 (2004), p. Unit 4 10. 176

(206) Referências Bibliográficas Chen, P.Y., Manninga, H., Slanchev, K., Chien, M., Russo, J.J., Ju, J., Sheridan, R., John, B., Marks, D.S., Gaidatzis, D., Sander, C., Zavolan, M. and Tuschl, T. The developmental miRNA profiles of zebrafish as determined by small RNA cloning. Genes Dev 19 (2005), pp. 1288-93. Chhabra, R., Dubey, R. and Saini, N. Cooperative and individualistic functions of the microRNAs in the miR-23a~27a~24-2 cluster and its implication in human diseases. Mol Cancer 9 (2010), p. 232. Choi, M.S., Yoo, A.S. and Greenwald, I. sel-11 and cdc-42, two negative modulators of LIN12/Notch activity in C. elegans. PLoS One 5 (2010), p. e11885. Cintron, N.S. and Toft, D. Defining the requirements for Hsp40 and Hsp70 in the Hsp90 chaperone pathway. J Biol Chem 281 (2006), pp. 26235-44. Clegg, J.A. In Vitro Cultivation of Schistosoma Mansoni. Exp Parasitol 16 (1965), pp. 13347. Colbourne, J.K., Pfrender, M.E., Gilbert, D., Thomas, W.K., Tucker, A., Oakley, T.H., Tokishita, S., Aerts, A., Arnold, G.J., Basu, M.K., Bauer, D.J., Caceres, C.E., Carmel, L., Casola, C., Choi, J.H., Detter, J.C., Dong, Q., Dusheyko, S., Eads, B.D., Frohlich, T., Geiler-Samerotte, K.A., Gerlach, D., Hatcher, P., Jogdeo, S., Krijgsveld, J., Kriventseva, E.V., Kultz, D., Laforsch, C., Lindquist, E., Lopez, J., Manak, J.R., Muller, J., Pangilinan, J., Patwardhan, R.P., Pitluck, S., Pritham, E.J., Rechtsteiner, A., Rho, M., Rogozin, I.B., Sakarya, O., Salamov, A., Schaack, S., Shapiro, H., Shiga, Y., Skalitzky, C., Smith, Z., Souvorov, A., Sung, W., Tang, Z., Tsuchiya, D., Tu, H., Vos, H., Wang, M., Wolf, Y.I., Yamagata, H., Yamada, T., Ye, Y., Shaw, J.R., Andrews, J., Crease, T.J., Tang, H., Lucas, S.M., Robertson, H.M., Bork, P., Koonin, E.V., Zdobnov, E.M., Grigoriev, I.V., Lynch, M. and Boore, J.L. The ecoresponsive genome of Daphnia pulex. Science 331 (2011), pp. 555-61. Collins, J.J., 3rd, King, R.S., Cogswell, A., Williams, D.L. and Newmark, P.A. An atlas for Schistosoma mansoni organs and life-cycle stages using cell type-specific markers and confocal microscopy. PLoS Negl Trop Dis 5 (2011), p. e1009. Copeland, C.S., Marz, M., Rose, D., Hertel, J., Brindley, P.J., Santana, C.B., Kehr, S., Attolini, C.S. and Stadler, P.F. Homology-based annotation of non-coding RNAs in the genomes of Schistosoma mansoni and Schistosoma japonicum. BMC Genomics 10 (2009), p. 464. Coura, J.R.A., R. S. Epidemiological and control aspects of schistosomiasis in Brazilian endemic areas. Mem Inst Oswaldo Cruz 99 (2004), pp. 13-9. 177

(207) Referências Bibliográficas Cousin, C.E. and Dorsey, C.H. Nervous system of Schistosoma mansoni cercaria: organization and fine structure. Parasitol Res 77 (1991), pp. 132-41. Crooks, G.E., Hon, G., Chandonia, J.M. and Brenner, S.E. WebLogo: a sequence logo generator. Genome Res 14 (2004), pp. 1188-90. Cui, Q., Yu, Z., Pan, Y., Purisima, E.O. and Wang, E. MicroRNAs preferentially target the genes with high transcriptional regulation complexity. Biochem Biophys Res Commun 352 (2007), pp. 733-8. Cunha, A.S. Esquistossomose mansoni. USP (1970), pp. 13-39. de Koning, A.P., Gu, W., Castoe, T.A., Batzer, M.A. and Pollock, D.D. Repetitive elements may comprise over two-thirds of the human genome. PLoS Genet 7 (2011), p. e1002384. de Lencastre, A., Pincus, Z., Zhou, K., Kato, M., Lee, S.S. and Slack, F.J. MicroRNAs both promote and antagonize longevity in C. elegans. Curr Biol 20 (2010), pp. 2159-68. de Souza Gomes, M., Muniyappa, M.K., Carvalho, S.G., Guerra-Sa, R. and Spillane, C. Genome-wide identification of novel microRNAs and their target genes in the human parasite Schistosoma mansoni. Genomics (2011). de Wit, E., Linsen, S.E., Cuppen, E. and Berezikov, E. Repertoire and evolution of miRNA genes in four divergent nematode species. Genome Res 19 (2009), pp. 2064-74. Debrand, E., El Jai, Y., Spence, L., Bate, N., Praekelt, U., Pritchard, C.A., Monkley, S.J. and Critchley, D.R. Talin 2 is a large and complex gene encoding multiple transcripts and protein isoforms. FEBS J 276 (2009), pp. 1610-28. Delano, W.L. The PyMOL Molecular Graphics System. CiteULike - (2002). DeMarco, R., Mathieson, W., Manuel, S.J., Dillon, G.P., Curwen, R.S., Ashton, P.D., Ivens, A.C., Berriman, M., Verjovski-Almeida, S. and Wilson, R.A. Protein variation in blood-dwelling schistosome worms generated by differential splicing of micro-exon gene transcripts. Genome Res 20 (2010), pp. 1112-21. DeMarco, R., Oliveira, K.C., Venancio, T.M. and Verjovski-Almeida, S. Gender biased differential alternative splicing patterns of the transcriptional cofactor CA150 gene in Schistosoma mansoni. Mol Biochem Parasitol 150 (2006), pp. 123-31. Denli, A.M. and Hannon, G.J. RNAi: an ever-growing puzzle. Trends Biochem Sci 28 (2003), pp. 196-201. Denli, A.M., Tops, B.B., Plasterk, R.H., Ketting, R.F. and Hannon, G.J. Processing of primary microRNAs by the Microprocessor complex. Nature 432 (2004), pp. 231-5. 178

(208) Referências Bibliográficas Dorsey, C.H., Cousin, C.E., Lewis, F.A. and Stirewalt, M.A. Ultrastructure of the Schistosoma mansoni cercaria. Micron 33 (2002), pp. 279-323. Enright, A.J., John, B., Gaul, U., Tuschl, T., Sander, C. and Marks, D.S. MicroRNA targets in Drosophila. Genome Biol 5 (2003), p. R1. Erasmus, D.A. A comparative study of the reproductive system of mature, immature and "unisexual" female Schistosoma mansoni. Parasitology 67 (1973), pp. 165-83. Esquela-Kerscher, A. and Slack, F.J. Oncomirs - microRNAs with a role in cancer. Nat Rev Cancer 6 (2006), pp. 259-69. Eulalio, A., Huntzinger, E. and Izaurralde, E. Getting to the root of miRNA-mediated gene silencing. Cell 132 (2008), pp. 9-14. Farazi, T.A., Spitzer, J.I., Morozov, P. and Tuschl, T. miRNAs in human cancer. J Pathol 223 (2011), pp. 102-15. Finn, R.D., Mistry, J., Tate, J., Coggill, P., Heger, A., Pollington, J.E., Gavin, O.L., Gunasekaran, P., Ceric, G., Forslund, K., Holm, L., Sonnhammer, E.L., Eddy, S.R. and Bateman, A. The Pfam protein families database. Nucleic Acids Res 38 (2010), pp. D211-22. Fitzpatrick, J.M., Peak, E., Perally, S., Chalmers, I.W., Barrett, J., Yoshino, T.P., Ivens, A.C. and Hoffmann, K.F. Anti-schistosomal intervention targets identified by lifecycle transcriptomic analyses. PLoS Negl Trop Dis 3 (2009), p. e543. Franco, G.R., Adams, M.D., Soares, M.B., Simpson, A.J., Venter, J.C. and Pena, S.D. Identification of new Schistosoma mansoni genes by the EST strategy using a directional cDNA library. Gene 152 (1995), pp. 141-7. Franco, G.R., Rabelo, E.M., Azevedo, V., Pena, H.B., Ortega, J.M., Santos, T.M., Meira, W.S., Rodrigues, N.A., Dias, C.M., Harrop, R., Wilson, A., Saber, M., Abdel-Hamid, H., Faria, M.S., Margutti, M.E., Parra, J.C. and Pena, S.D. Evaluation of cDNA libraries from different developmental stages of Schistosoma mansoni for production of expressed sequence tags (ESTs). DNA Res 4 (1997), pp. 231-40. Franco, G.R., Valadao, A.F., Azevedo, V. and Rabelo, E.M. The Schistosoma gene discovery program: state of the art. Int J Parasitol 30 (2000), pp. 453-63. Friedlander, M.R., Chen, W., Adamidi, C., Maaskola, J., Einspanier, R., Knespel, S. and Rajewsky, N. Discovering microRNAs from deep sequencing data using miRDeep. Nat Biotechnol 26 (2008), pp. 407-15. Friedman, R.C., Farh, K.K., Burge, C.B. and Bartel, D.P. Most mammalian mRNAs are conserved targets of microRNAs. Genome Res 19 (2009), pp. 92-105. 179

(209) Referências Bibliográficas Fuji, I. Katayama disease. Katayamaki: Chugai Iji Shimpo 691 (1847), pp. 55-56 Gaidatzis, D., van Nimwegen, E., Hausser, J. and Zavolan, M. Inference of miRNA targets using evolutionary conservation and pathway analysis. BMC Bioinformatics 8 (2007), p. 69. Gkirtzou, K., Tsamardinos, I., Tsakalides, P. and Poirazi, P. MatureBayes: a probabilistic algorithm for identifying the mature miRNA within novel precursors. PLoS One 5 (2010), p. e11843. Gobert, G.N., McManus, D.P., Nawaratna, S., Moertel, L., Mulvenna, J. and Jones, M.K. Tissue specific profiling of females of Schistosoma japonicum by integrated laser microdissection microscopy and microarray analysis. PLoS Negl Trop Dis 3 (2009a), p. e469. Gobert, G.N., Moertel, L., Brindley, P.J. and McManus, D.P. Developmental gene expression profiles of the human pathogen Schistosoma japonicum. BMC Genomics 10 (2009b), p. 128. Gomes, M.S., Cabral, F.J., Jannotti-Passos, L.K., Carvalho, O., Rodrigues, V., Baba, E.H. and Sa, R.G. Preliminary analysis of miRNA pathway in Schistosoma mansoni. Parasitol Int 58 (2009), pp. 61-8. Griffiths-Jones, S. miRBase: microRNA sequences and annotation. Curr Protoc Bioinformatics Chapter 12 (2010), pp. Unit 12 9 1-10. Grimson, A., Farh, K.K., Johnston, W.K., Garrett-Engele, P., Lim, L.P. and Bartel, D.P. MicroRNA targeting specificity in mammals: determinants beyond seed pairing. Mol Cell 27 (2007), pp. 91-105. Guo, X., Su, B., Zhou, Z. and Sha, J. Rapid evolution of mammalian X-linked testis microRNAs. BMC Genomics 10 (2009), p. 97. Hammond, S.M. microRNA detection comes of age. Nat Methods 3 (2006), pp. 12-3. Han, J., Lee, Y., Yeom, K.H., Nam, J.W., Heo, I., Rhee, J.K., Sohn, S.Y., Cho, Y., Zhang, B.T. and Kim, V.N. Molecular basis for the recognition of primary microRNAs by the Drosha-DGCR8 complex. Cell 125 (2006), pp. 887-901. Han, Z.G., Brindley, P.J., Wang, S.Y. and Chen, Z. Schistosoma genomics: new perspectives on schistosome biology and host-parasite interaction. Annu Rev Genomics Hum Genet 10 (2009), pp. 211-40. Hao, L., Cai, P., Jiang, N., Wang, H. and Chen, Q. Identification and characterization of microRNAs and endogenous siRNAs in Schistosoma japonicum. BMC Genomics 11 (2010), p. 55. 180

(210) Referências Bibliográficas Harrop, R. and Wilson, R.A. Protein synthesis and release by cultured schistosomula of Schistosoma mansoni. Parasitology 107 ( Pt 3) (1993), pp. 265-74. Hasegawa, D., Fujii, R., Yagishita, N., Matsumoto, N., Aratani, S., Izumi, T., Azakami, K., Nakazawa, M., Fujita, H., Sato, T., Araya, N., Koike, J., Tadokoro, M., Suzuki, N., Nagata, K., Senoo, H., Friedman, S.L., Nishioka, K., Yamano, Y., Itoh, F. and Nakajima, T. E3 ubiquitin ligase synoviolin is involved in liver fibrogenesis. PLoS One 5 (2010), p. e13590. Hausser, J., Berninger, P., Rodak, C., Jantscher, Y., Wirth, S. and Zavolan, M. MirZ: an integrated microRNA expression atlas and target prediction resource. Nucleic Acids Res 37 (2009), pp. W266-72. Hayashita, Y., Osada, H., Tatematsu, Y., Yamada, H., Yanagisawa, K., Tomida, S., Yatabe, Y., Kawahara, K., Sekido, Y. and Takahashi, T. A polycistronic microRNA cluster, miR-17-92, is overexpressed in human lung cancers and enhances cell proliferation. Cancer Res 65 (2005), pp. 9628-32. Hertel, J., Lindemeyer, M., Missal, K., Fried, C., Tanzer, A., Flamm, C., Hofacker, I.L. and Stadler, P.F. The expansion of the metazoan microRNA repertoire. BMC Genomics 7 (2006), p. 25. Hofacker, I.L. RNA secondary structure analysis using the Vienna RNA package. Curr Protoc Bioinformatics Chapter 12 (2009), p. Unit12 2. Hoogeveen, A.T., Willemsen, R. and Oostra, B.A. Fragile X syndrome, the Fragile X related proteins, and animal models. Microsc Res Tech 57 (2002), pp. 148-55. Howard-Till, R.A. and Yao, M.C. Tudor nuclease genes and programmed DNA rearrangements in Tetrahymena thermophila. Eukaryot Cell 6 (2007), pp. 1795-804. Huang, J., Hao, P., Chen, H., Hu, W., Yan, Q., Liu, F. and Han, Z.G. Genome-wide identification of Schistosoma japonicum microRNAs using a deep-sequencing approach. PLoS One 4 (2009), p. e8206. Huang, T.H., Fan, B., Rothschild, M.F., Hu, Z.L., Li, K. and Zhao, S.H. MiRFinder: an improved approach and software implementation for genome-wide fast microRNA precursor scans. BMC Bioinformatics 8 (2007), p. 341. Huang, Y., Shen, X.J., Zou, Q., Huang, J.S. and Tang, S.M. Genomic analysis of silkworm microRNA promoters and clusters. Mol Biol (Mosk) 45 (2011), pp. 225-30. Huang, Y., Zou, Q., Wang, S.P., Tang, S.M., Zhang, G.Z. and Shen, X.J. The discovery approaches and detection methods of microRNAs. Mol Biol Rep (2010). 181

(211) Referências Bibliográficas Huttenhofer, A. and Vogel, J. Experimental approaches to identify non-coding RNAs. Nucleic Acids Res 34 (2006), pp. 635-46. Jaskiewicz, L. and Filipowicz, W. Role of Dicer in posttranscriptional RNA silencing. Curr Top Microbiol Immunol 320 (2008), pp. 77-97. Jiang, P., Wu, H., Wang, W., Ma, W., Sun, X. and Lu, Z. MiPred: classification of real and pseudo microRNA precursors using random forest prediction model with combined features. Nucleic Acids Res 35 (2007), pp. W339-44. Jin, P., Zarnescu, D.C., Ceman, S., Nakamoto, M., Mowrey, J., Jongens, T.A., Nelson, D.L., Moses, K. and Warren, S.T. Biochemical and genetic interaction between the fragile X mental retardation protein and the microRNA pathway. Nat Neurosci 7 (2004), pp. 113-7. John, B., Enright, A.J., Aravin, A., Tuschl, T., Sander, C. and Marks, D.S. Human MicroRNA targets. PLoS Biol 2 (2004), p. e363. Jones-Rhoades, M.W. and Bartel, D.P. Computational identification of plant microRNAs and their targets, including a stress-induced miRNA. Mol Cell 14 (2004), pp. 787-99. Jones, M. and Blaxter, M. Evolutionary biology: animal roots and shoots. Nature 434 (2005), pp. 1076-7. Jurberg, A.D., Goncalves, T., Costa, T.A., de Mattos, A.C., Pascarelli, B.M., de Manso, P.P., Ribeiro-Alves, M., Pelajo-Machado, M., Peralta, J.M., Coelho, P.M. and Lenzi, H.L. The embryonic development of Schistosoma mansoni eggs: proposal for a new staging system. Dev Genes Evol 219 (2009), pp. 219-34. Keene, J.D. RNA regulons: coordination of post-transcriptional events. Nat Rev Genet 8 (2007), pp. 533-43. Kertesz, M., Iovino, N., Unnerstall, U., Gaul, U. and Segal, E. The role of site accessibility in microRNA target recognition. Nat Genet 39 (2007), pp. 1278-84. Kiefer, F., Arnold, K., Kunzli, M., Bordoli, L. and Schwede, T. The SWISS-MODEL Repository and associated resources. Nucleic Acids Res 37 (2009), pp. D387-92. Kim, S.K., Nam, J.W., Rhee, J.K., Lee, W.J. and Zhang, B.T. miTarget: microRNA target gene prediction using a support vector machine. BMC Bioinformatics 7 (2006), p. 411. Kim, V.N. and Nam, J.W. Genomics of microRNA. Trends Genet 22 (2006), pp. 165-73. Kozaki, K., Imoto, I., Mogi, S., Omura, K. and Inazawa, J. Exploration of tumor-suppressive microRNAs silenced by DNA hypermethylation in oral cancer. Cancer Res 68 (2008), pp. 2094-105. 182

(212) Referências Bibliográficas Kozomara, A. and Griffiths-Jones, S. miRBase: integrating microRNA annotation and deepsequencing data. Nucleic Acids Res 39 (2011), pp. D152-7. Krautz-Peterson, G. and Skelly, P.J. Schistosoma mansoni: the dicer gene and its expression. Exp Parasitol 118 (2008), pp. 122-8. Kruger, J. and Rehmsmeier, M. RNAhybrid: microRNA target prediction easy, fast and flexible. Nucleic Acids Res 34 (2006), pp. W451-4. Lagos-Quintana, M., Rauhut, R., Meyer, J., Borkhardt, A. and Tuschl, T. New microRNAs from mouse and human. RNA 9 (2003), pp. 175-9. Lai, E.C. Micro RNAs are complementary to 3' UTR sequence motifs that mediate negative post-transcriptional regulation. Nat Genet 30 (2002), pp. 363-4. Lai, E.C., Tomancak, P., Williams, R.W. and Rubin, G.M. Computational identification of Drosophila microRNA genes. Genome Biol 4 (2003), p. R42. Lall, S., Grun, D., Krek, A., Chen, K., Wang, Y.L., Dewey, C.N., Sood, P., Colombo, T., Bray, N., Macmenamin, P., Kao, H.L., Gunsalus, K.C., Pachter, L., Piano, F. and Rajewsky, N. A genome-wide map of conserved microRNA targets in C. elegans. Curr Biol 16 (2006), pp. 460-71. Larkin, M.A., Blackshields, G., Brown, N.P., Chenna, R., McGettigan, P.A., McWilliam, H., Valentin, F., Wallace, I.M., Wilm, A., Lopez, R., Thompson, J.D., Gibson, T.J. and Higgins, D.G. Clustal W and Clustal X version 2.0. Bioinformatics 23 (2007), pp. 2947-8. Le Paslier, M.C., Pierce, R.J., Merlin, F., Hirai, H., Wu, W., Williams, D.L., Johnston, D., LoVerde, P.T. and Le Paslier, D. Construction and characterization of a Schistosoma mansoni bacterial artificial chromosome library. Genomics 65 (2000), pp. 87-94. Lee, H.C., Li, L., Gu, W., Xue, Z., Crosthwaite, S.K., Pertsemlidis, A., Lewis, Z.A., Freitag, M., Selker, E.U., Mello, C.C. and Liu, Y. Diverse pathways generate microRNA-like RNAs and Dicer-independent small interfering RNAs in fungi. Mol Cell 38 (2010), pp. 803-14. Lee, R.C., Feinbaum, R.L. and Ambros, V. The C. elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14. Cell 75 (1993), pp. 843-54. Lee, Y., Ahn, C., Han, J., Choi, H., Kim, J., Yim, J., Lee, J., Provost, P., Radmark, O., Kim, S. and Kim, V.N. The nuclear RNase III Drosha initiates microRNA processing. Nature 425 (2003), pp. 415-9. 183

(213) Referências Bibliográficas Lee, Y.S., Nakahara, K., Pham, J.W., Kim, K., He, Z., Sontheimer, E.J. and Carthew, R.W. Distinct roles for Drosophila Dicer-1 and Dicer-2 in the siRNA/miRNA silencing pathways. Cell 117 (2004), pp. 69-81. Lemons, D. and McGinnis, W. Genomic evolution of Hox gene clusters. Science 313 (2006), pp. 1918-22. Leuschner, P.J., Obernosterer, G. and Martinez, J. MicroRNAs: Loquacious speaks out. Curr Biol 15 (2005), pp. R603-5. Lewis, B.P., Burge, C.B. and Bartel, D.P. Conserved seed pairing, often flanked by adenosines, indicates that thousands of human genes are microRNA targets. Cell 120 (2005), pp. 15-20. Lewis, B.P., Shih, I.H., Jones-Rhoades, M.W., Bartel, D.P. and Burge, C.B. Prediction of mammalian microRNA targets. Cell 115 (2003), pp. 787-98. Li, C.L., Yang, W.Z., Chen, Y.P. and Yuan, H.S. Structural and functional insights into human Tudor-SN, a key component linking RNA interference and editing. Nucleic Acids Res 36 (2008), pp. 3579-89. Li, L., Xu, J., Yang, D., Tan, X. and Wang, H. Computational approaches for microRNA studies: a review. Mamm Genome 21 (2010a), pp. 1-12. Li, S.C., Chan, W.C., Hu, L.Y., Lai, C.H., Hsu, C.N. and Lin, W.C. Identification of homologous microRNAs in 56 animal genomes. Genomics 96 (2010b), pp. 1-9. Li, S.C., Pan, C.Y. and Lin, W.C. Bioinformatic discovery of microRNA precursors from human ESTs and introns. BMC Genomics 7 (2006), pp. -. Li, S.C., Tang, P. and Lin, W.C. Intronic microRNA: discovery and biological implications. DNA Cell Biol 26 (2007), pp. 195-207. Lim, L.P., Lau, N.C., Weinstein, E.G., Abdelhakim, A., Yekta, S., Rhoades, M.W., Burge, C.B. and Bartel, D.P. The microRNAs of Caenorhabditis elegans. Genes Dev 17 (2003), pp. 991-1008. Lindow, M. Prediction of targets for microRNAs. Methods Mol Biol 703 (2011), pp. 311-7. Liu, J., Valencia-Sanchez, M.A., Hannon, G.J. and Parker, R. MicroRNA-dependent localization of targeted mRNAs to mammalian P-bodies. Nat Cell Biol 7 (2005), pp. 719-23. Luo, R., Xue, X., Wang, Z., Sun, J., Zou, Y. and Pan, W. Analysis and characterization of the genes encoding the Dicer and Argonaute proteins of Schistosoma japonicum. Parasit Vectors 3 (2010), p. 90. 184

(214) Referências Bibliográficas Lytle, J.R., Yario, T.A. and Steitz, J.A. Target mRNAs are repressed as efficiently by microRNA-binding sites in the 5' UTR as in the 3' UTR. Proc Natl Acad Sci U S A 104 (2007), pp. 9667-72. Maher, C., Stein, L. and Ware, D. Evolution of Arabidopsis microRNA families through duplication events. Genome Res 16 (2006), pp. 510-9. Manson, P. Report of a case of bilharzia from West Indies. Brit Med J 2 (1902), pp. 18941995. Maragkakis, M., Reczko, M., Simossis, V.A., Alexiou, P., Papadopoulos, G.L., Dalamagas, T., Giannopoulos, G., Goumas, G., Koukis, E., Kourtis, K., Vergoulis, T., Koziris, N., Sellis, T., Tsanakas, P. and Hatzigeorgiou, A.G. DIANA-microT web server: elucidating microRNA functions through target prediction. Nucleic Acids Res 37 (2009), pp. W273-6. Marco, A., Hui, J.H., Ronshaugen, M. and Griffiths-Jones, S. Functional shifts in insect microRNA evolution. Genome Biol Evol 2 (2010), pp. 686-96. Mazroui, R., Huot, M.E., Tremblay, S., Filion, C., Labelle, Y. and Khandjian, E.W. Trapping of messenger RNA by Fragile X Mental Retardation protein into cytoplasmic granules induces translation repression. Human Molecular Genetics 11 (2002), pp. 3007-17. Megraw, M., Sethupathy, P., Corda, B. and Hatzigeorgiou, A.G. miRGen: a database for the study of animal microRNA genomic organization and function. Nucleic Acids Res 35 (2007), pp. D149-55. Meister, G. and Tuschl, T. Mechanisms of gene silencing by double-stranded RNA. Nature 431 (2004), pp. 343-9. Mendes, N.D., Freitas, A.T. and Sagot, M.F. Current tools for the identification of miRNA genes and their targets. Nucleic Acids Res 37 (2009), pp. 2419-33. Mi, S.J., Cai, T., Hu, Y.G., Chen, Y., Hodges, E., Ni, F.R., Wu, L., Li, S., Zhou, H., Long, C.Z., Chen, S., Hannon, G.J. and Qi, Y.J. Sorting of small RNAs into Arabidopsis argonaute complexes is directed by the 5 ' terminal nucleotide. Cell 133 (2008), pp. 116-127. Mishima, T., Takizawa, T., Luo, S.S., Ishibashi, O., Kawahigashi, Y., Mizuguchi, Y., Ishikawa, T., Mori, M., Kanda, T. and Goto, T. MicroRNA (miRNA) cloning analysis reveals sex differences in miRNA expression profiles between adult mouse testis and ovary. Reproduction 136 (2008), pp. 811-22. 185

(215) Referências Bibliográficas Morales, J., Hiesinger, P.R., Schroeder, A.J., Kume, K., Verstreken, P., Jackson, F.R., Nelson, D.L. and Hassan, B.A. Drosophila fragile X protein, DFXR, regulates neuronal morphology and function in the brain. Neuron 34 (2002), pp. 961-72. Mourelatos, Z., Dostie, J., Paushkin, S., Sharma, A., Charroux, B., Abel, L., Rappsilber, J., Mann, M. and Dreyfuss, G. miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs. Genes Dev 16 (2002), pp. 720-8. Murphy, D., Dancis, B. and Brown, J.R. The evolution of core proteins involved in microRNA biogenesis. BMC Evol Biol 8 (2008), p. 92. Nam, S., Kim, B., Shin, S. and Lee, S. miRGator: an integrated system for functional annotation of microRNAs. Nucleic Acids Res 36 (2008), pp. D159-64. Naqvi, A.R., Islam, M.N., Choudhury, N.R. and Haq, Q.M. The fascinating world of RNA interference. Int J Biol Sci 5 (2009), pp. 97-117. Noguer-Dance, M., Abu-Amero, S., Al-Khtib, M., Lefevre, A., Coullin, P., Moore, G.E. and Cavaille, J. The primate-specific microRNA gene cluster (C19MC) is imprinted in the placenta. Human Molecular Genetics 19 (2010), pp. 3566-3582. Ojopi, E.P., Oliveira, P.S., Nunes, D.N., Paquola, A., DeMarco, R., Gregorio, S.P., Aires, K.A., Menck, C.F., Leite, L.C., Verjovski-Almeida, S. and Dias-Neto, E. A quantitative view of the transcriptome of Schistosoma mansoni adult-worms using SAGE. BMC Genomics 8 (2007), p. 186. Okamura, K., Phillips, M.D., Tyler, D.M., Duan, H., Chou, Y.T. and Lai, E.C. The regulatory activity of microRNA* species has substantial influence on microRNA and 3' UTR evolution. Nat Struct Mol Biol 15 (2008), pp. 354-63. Oliveira, G. The Schistosoma mansoni transcriptome: an update. Exp Parasitol 117 (2007), pp. 229-35. Oliveira, G., Franco, G. and Verjovski-Almeida, S. The Brazilian contribution to the study of the Schistosoma mansoni transcriptome. Acta Trop 108 (2008), pp. 179-82. Papadopoulos, G.L., Alexiou, P., Maragkakis, M., Reczko, M. and Hatzigeorgiou, A.G. DIANA-mirPath: Integrating human and mouse microRNAs in pathways. Bioinformatics 25 (2009), pp. 1991-3. Paraense, W.L. "Biomphalaria Amazonica" and "B. cousini", two new species of neotropical planorbid molluscs. Rev Bras Biol 26 (1966), pp. 115-26. Paraense, W.L. Biomphalaria occidentalis sp. n. from South America (Mollusca Basommatophora Pulmonata). Mem Inst Oswaldo Cruz 76 (1981), pp. 199-211. 186

(216) Referências Bibliográficas Park, J.K., Liu, X., Strauss, T.J., McKearin, D.M. and Liu, Q. The miRNA pathway intrinsically controls self-renewal of Drosophila germline stem cells. Curr Biol 17 (2007), pp. 533-8. Parker-Manuel, S.J., Ivens, A.C., Dillon, G.P. and Wilson, R.A. Gene expression patterns in larval Schistosoma mansoni associated with infection of the mammalian host. PLoS Negl Trop Dis 5 (2011), p. e1274. Passos, A.D.C. Controle da esquistossomose: diretrizes técnicas. (1998). Phelan, P. Innexins: members of an evolutionarily conserved family of gap-junction proteins. Biochim Biophys Acta 1711 (2005), pp. 225-45. Pierce, R.J., Dubois-Abdesselem, F., Caby, S., Trolet, J., Lancelot, J., Oger, F., Bertheaume, N. and Roger, E. Chromatin regulation in schistosomes and histone modifying enzymes as drug targets. Mem Inst Oswaldo Cruz 106 (2011), pp. 794-801. Pierce, R.J., Wu, W., Hirai, H., Ivens, A., Murphy, L.D., Noel, C., Johnston, D.A., Artiguenave, F., Adams, M., Cornette, J., Viscogliosi, E., Capron, M. and Balavoine, G. Evidence for a dispersed Hox gene cluster in the platyhelminth parasite Schistosoma mansoni. Mol Biol Evol 22 (2005), pp. 2491-503. Pirajá da Silva, M.A. Contribuição para o estudo da schistosomiase na Bahia. Brazil-méd 22 (1908), pp. 281-283. Potenza, N., Papa, U., Scaruffi, P., Mosca, N., Tonini, G.P. and Russo, A. A novel splice variant of the human dicer gene is expressed in neuroblastoma cells. FEBS Lett 584 (2010), pp. 3452-7. Puzey, J.R. and Kramer, E.M. Identification of conserved Aquilegia coerulea microRNAs and their targets. Gene 448 (2009), pp. 46-56. Rabelo, E.M., Franco, G.R., Azevedo, V.A., Pena, H.B., Santos, T.M., Meira, W.S., Rodrigues, N.A., Ortega, J.M. and Pena, S.D. Update of the gene discovery program in Schistosoma mansoni with the expressed sequence tag approach. Mem Inst Oswaldo Cruz 92 (1997), pp. 625-9. Ramalho-Pinto, F.J., Gazzinelli, G., Howells, R.E., Mota-Santos, T.A., Figueiredo, E.A. and Pellegrino, J. Schistosoma mansoni: defined system for stepwise transformation of cercaria to schistosomule in vitro. Exp Parasitol 36 (1974), pp. 360-72. Reinhart, B.J., Slack, F.J., Basson, M., Pasquinelli, A.E., Bettinger, J.C., Rougvie, A.E., Horvitz, H.R. and Ruvkun, G. The 21-nucleotide let-7 RNA regulates developmental timing in Caenorhabditis elegans. Nature 403 (2000), pp. 901-6. 187

(217) Referências Bibliográficas Rey, L. Parasitologia: parasitos e doenças parasitárias do homem nas Américas e na África. Guanabara 1 (2001), p. 856. Roberts, L.S.J., J. Foundations of parasitology. Science (2000). Rost, B. and Liu, J. The PredictProtein server. Nucleic Acids Res 31 (2003), pp. 3300-4. Rost, B., Yachdav, G. and Liu, J. The PredictProtein server. Nucleic Acids Res 32 (2004), pp. W321-6. Roubelakis, M.G., Zotos, P., Papachristoudis, G., Michalopoulos, I., Pappa, K.I., Anagnou, N.P. and Kossida, S. Human microRNA target analysis and gene ontology clustering by GOmir, a novel stand-alone application. BMC Bioinformatics 10 Suppl 6 (2009), p. S20. Roush, S. and Slack, F.J. The let-7 family of microRNAs. Trends Cell Biol 18 (2008), pp. 505-16. Saini, H.K., Enright, A.J. and Griffiths-Jones, S. Annotation of mammalian primary microRNAs. BMC Genomics 9 (2008), p. 564. Saini, H.K., Griffiths-Jones, S. and Enright, A.J. Genomic analysis of human microRNA transcripts. Proc Natl Acad Sci U S A 104 (2007), pp. 17719-24. Saito, K., Ishizuka, A., Siomi, H. and Siomi, M.C. Processing of pre-microRNAs by the Dicer-1-Loquacious complex in Drosophila cells. PLoS Biol 3 (2005), p. e235. Saitou, N. and Nei, M. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol Biol Evol 4 (1987), pp. 406-25. Sambon, L.W. Remarks on Schistosoma mansoni. Am J Trop Med Hyg 10 (1907), pp. 303304. Schmittgen, T.D. Regulation of microRNA processing in development, differentiation and cancer. J Cell Mol Med 12 (2008), pp. 1811-9. Sethupathy, P., Corda, B. and Hatzigeorgiou, A.G. TarBase: A comprehensive database of experimentally supported animal microRNA targets. RNA 12 (2006a), pp. 192-7. Sethupathy, P., Megraw, M. and Hatzigeorgiou, A.G. A guide through present computational approaches for the identification of mammalian microRNA targets. Nat Methods 3 (2006b), pp. 881-6. Sharbati-Tehrani, S., Kutz-Lohroff, B., Bergbauer, R., Scholven, J. and Einspanier, R. miRQ: a novel quantitative RT-PCR approach for the expression profiling of small RNA molecules such as miRNAs in a complex sample. BMC Mol Biol 9 (2008), p. 34. Sheng, Y., Engstrom, P.G. and Lenhard, B. Mammalian microRNA prediction through a support vector machine model of sequence and structure. PLoS One 2 (2007), p. e946. 188

(218) Referências Bibliográficas Short, R.B. and Menzel, M.Y. Chromosomes of nine species of schistosomes. J Parasitol 46 (1960), pp. 273-87. Short, R.B., Menzel, M.Y. and Pathak, S. Somatic chromosomes of Schistosoma mansoni. J Parasitol 65 (1979), pp. 471-3. Simoes, M.C., Lee, J., Djikeng, A., Cerqueira, G.C., Zerlotini, A., da Silva-Pereira, R.A., Dalby, A.R., LoVerde, P., El-Sayed, N.M. and Oliveira, G. Identification of Schistosoma mansoni microRNAs. BMC Genomics 12 (2011), p. 47. Simpson, A.J., Sher, A. and McCutchan, T.F. The genome of Schistosoma mansoni: isolation of DNA, its size, bases and repetitive sequences. Mol Biochem Parasitol 6 (1982), pp. 125-37. Smithers, S.R. and Terry, R.J. The infection of laboratory hosts with cercariae of Schistosoma mansoni and the recovery of the adult worms. Parasitology 55 (1965), pp. 695-700. Song, R., Ro, S., Michaels, J.D., Park, C., McCarrey, J.R. and Yan, W. Many X-linked microRNAs escape meiotic sex chromosome inactivation. Nature Genetics 41 (2009), pp. 488-493. Takane, K., Fujishima, K., Watanabe, Y., Sato, A., Saito, N., Tomita, M. and Kanai, A. Computational prediction and experimental validation of evolutionarily conserved microRNA target genes in bilaterian animals. BMC Genomics 11 (2010), p. 101. Tamura, K., Dudley, J., Nei, M. and Kumar, S. MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol Biol Evol 24 (2007), pp. 1596-9. Tanzer, A. and Stadler, P.F. Molecular evolution of a microRNA cluster. J Mol Biol 339 (2004), pp. 327-35. Thompson, J.D., Gibson, T.J. and Higgins, D.G. Multiple sequence alignment using ClustalW and ClustalX. Curr Protoc Bioinformatics Chapter 2 (2002), p. Unit 2 3. Tsuchimochi, K., Yagishita, N., Yamasaki, S., Amano, T., Kato, Y., Kawahara, K., Aratani, S., Fujita, H., Ji, F., Sugiura, A., Izumi, T., Sugamiya, A., Maruyama, I., Fukamizu, A., Komiya, S., Nishioka, K. and Nakajima, T. Identification of a crucial site for synoviolin expression. Mol Cell Biol 25 (2005), pp. 7344-56. Verjovski-Almeida, S., DeMarco, R., Martins, E.A., Guimaraes, P.E., Ojopi, E.P., Paquola, A.C., Piazza, J.P., Nishiyama, M.Y., Jr., Kitajima, J.P., Adamson, R.E., Ashton, P.D., Bonaldo, M.F., Coulson, P.S., Dillon, G.P., Farias, L.P., Gregorio, S.P., Ho, P.L., Leite, R.A., Malaquias, L.C., Marques, R.C., Miyasato, P.A., Nascimento, A.L., Ohlweiler, F.P., Reis, E.M., Ribeiro, M.A., Sa, R.G., Stukart, G.C., Soares, M.B., 189

(219) Referências Bibliográficas Gargioni, C., Kawano, T., Rodrigues, V., Madeira, A.M., Wilson, R.A., Menck, C.F., Setubal, J.C., Leite, L.C. and Dias-Neto, E. Transcriptome analysis of the acoelomate human parasite Schistosoma mansoni. Nat Genet 35 (2003), pp. 148-57. Voinnet, O. Origin, biogenesis, and activity of plant microRNAs. Cell 136 (2009), pp. 66987. Von Stetina, J.R. and Orr-Weaver, T.L. Developmental control of oocyte maturation and egg activation in metazoan models. Cold Spring Harb Perspect Biol 3 (2011), p. a005553. Wang, X. and El Naqa, I.M. Prediction of both conserved and nonconserved microRNA targets in animals. Bioinformatics 24 (2008), pp. 325-32. Wang, X., Zhang, J., Li, F., Gu, J., He, T., Zhang, X. and Li, Y. MicroRNA identification based on sequence and structure alignment. Bioinformatics 21 (2005), pp. 3610-4. Wang, Z., Xue, X., Sun, J., Luo, R., Xu, X., Jiang, Y., Zhang, Q. and Pan, W. An "in-depth" description of the small non-coding RNA population of Schistosoma japonicum schistosomulum. PLoS Negl Trop Dis 4 (2010), p. e596. Warf, M.B., Johnson, W.E. and Bass, B.L. Improved annotation of C. elegans microRNAs by deep sequencing reveals structures associated with processing by Drosha and Dicer. RNA 17 (2011), pp. 563-77. Watanabe, Y., Tomita, M. and Kanai, A. Computational methods for microRNA target prediction. Methods Enzymol 427 (2007), pp. 65-86. Westholm, J.O. and Lai, E.C. Mirtrons: microRNA biogenesis via splicing. Biochimie 93 (2011), pp. 1897-904. Whitten, S.J. and Miller, M.A. The role of gap junctions in Caenorhabditis elegans oocyte maturation and fertilization. Dev Biol 301 (2007), pp. 432-46. WHO Working to overcome the global impact of neglected tropical diseases. (2010). Wilson, R.A., Ashton, P.D., Braschi, S., Dillon, G.P., Berriman, M. and Ivens, A. 'Oming in on schistosomes: prospects and limitations for post-genomics. Trends Parasitol 23 (2007), pp. 14-20. Wilson, R.A. and Barnes, P.E. Synthesis of macromolecules by the epithelial surfaces of Schistosoma mansoni: an autoradiographic study. Parasitology 78 (1979), pp. 295310. Winter, J. and Diederichs, S. MicroRNA Northern blotting, precursor cloning, and Ago2improved RNA interference. Methods Mol Biol 676 (2011), pp. 85-100. 190

(220) Referências Bibliográficas Winter, J., Jung, S., Keller, S., Gregory, R.I. and Diederichs, S. Many roads to maturity: microRNA biogenesis pathways and their regulation. Nat Cell Biol 11 (2009), pp. 228-34. Wong, T.S., Liu, X.B., Wong, B.Y., Ng, R.W., Yuen, A.P. and Wei, W.I. Mature miR-184 as Potential Oncogenic microRNA of Squamous Cell Carcinoma of Tongue. Clin Cancer Res 14 (2008), pp. 2588-92. Wouters, B.G. and Koritzinsky, M. Hypoxia signalling through mTOR and the unfolded protein response in cancer. Nat Rev Cancer 8 (2008), pp. 851-64. Xiao, F., Zuo, Z., Cai, G., Kang, S., Gao, X. and Li, T. miRecords: an integrated resource for microRNA-target interactions. Nucleic Acids Res 37 (2009), pp. D105-10. Xue, C., Li, F., He, T., Liu, G.P., Li, Y. and Zhang, X. Classification of real and pseudo microRNA precursors using local structure-sequence features and support vector machine. BMC Bioinformatics 6 (2005), p. 310. Xue, X., Sun, J., Zhang, Q., Wang, Z., Huang, Y. and Pan, W. Identification and characterization of novel microRNAs from Schistosoma japonicum. PLoS One 3 (2008), p. e4034. Yagishita, N., Ohneda, K., Amano, T., Yamasaki, S., Sugiura, A., Tsuchimochi, K., Shin, H., Kawahara, K., Ohneda, O., Ohta, T., Tanaka, S., Yamamoto, M., Maruyama, I., Nishioka, K., Fukamizu, A. and Nakajima, T. Essential role of synoviolin in embryogenesis. J Biol Chem 280 (2005), pp. 7909-16. Yamasaki, S., Yagishita, N., Nishioka, K. and Nakajima, T. The roles of synoviolin in crosstalk between endoplasmic reticulum stress-induced apoptosis and p53 pathway. Cell Cycle 6 (2007), pp. 1319-23. Yang, J., Valineva, T., Hong, J., Bu, T., Yao, Z., Jensen, O.N., Frilander, M.J. and Silvennoinen, O. Transcriptional co-activator protein p100 interacts with snRNP proteins and facilitates the assembly of the spliceosome. Nucleic Acids Res 35 (2007), pp. 4485-94. Zhang, B., Pan, X., Cannon, C.H., Cobb, G.P. and Anderson, T.A. Conservation and divergence of plant microRNA genes. Plant J 46 (2006a), pp. 243-59. Zhang, B., Pan, X., Wang, Q., Cobb, G.P. and Anderson, T.A. Computational identification of microRNAs and their targets. Comput Biol Chem 30 (2006b), pp. 395-407. Zhang, Q., He, X.J., Liu, Y.J., Ma, L.P. and Pan, X.Y. [Profiling of microRNAs in mouse brain with real-time PCR array]. Beijing Da Xue Xue Bao 41 (2009a), pp. 152-7. 191

(221) Referências Bibliográficas Zhang, R., Peng, Y., Wang, W. and Su, B. Rapid evolution of an X-linked microRNA cluster in primates. Genome Res 17 (2007), pp. 612-7. Zhang, Y., Zhang, R. and Su, B. Diversity and evolution of MicroRNA gene clusters. Sci China C Life Sci 52 (2009b), pp. 261-6. Zhang, Y.Q., Chen, D.L., Tian, H.F., Zhang, B.H. and Wen, J.F. Genome-wide computational identification of microRNAs and their targets in the deep-branching eukaryote Giardia lamblia. Comput Biol Chem 33 (2009c), pp. 391-6. Zheng, J., Lu, J., Liu, H., Li, J. and Chen, K. Sequence and structural analysis of 4SNc-Tudor domain protein from Takifugu Rubripes. Bioinformation 4 (2009), pp. 127-31. Zhou, M., Wang, Q., Sun, J., Li, X., Xu, L., Yang, H., Shi, H., Ning, S., Chen, L., Li, Y., He, T. and Zheng, Y. In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach. Genomics 94 (2009), pp. 125-31. 192

(222) Anexo Anexo A B 193

(223) Anexo C D 194

(224) Anexo E F 195

(225) Anexo G H 196

(226) Anexo I J 197

(227) Anexo L M 198

(228) Anexo N Figura 1: Distribuição dos valores relacionados às características (A) Conteúdo de A e (B) AMFE, (C) Conteúdo de AU, (D) Conteúdo de C, (E) Diversidade do Conjunto, (F) Frequência do MFE no conjunto termodinâmico, (G) Conteúdo de G, (H) Taxa de GC, (I) Tamanho, (J) MFE no conjunto termodinâmico, (L) MFEI, (M) Conteúdo de U e (N) Taxa de AU dos novos precursores de miRNAs. Os valores utilizados na confecção dos gráficos foram baseados em precursores de miRNAs depositados no banco de dados miRBase. Os nomes dos novos miRNA estão representados em cada gráfico do grupo de miRNA correspondente. As caixas representam 50% dos dados analisados. A extremidade mais baixa representa o primeiro quartil ou 25 % dos dados e a extremidade mais alta representa o terceiro quartil ou 75 % dos dados. A linha horizontal dentro da caixa representa a mediana e os valores maiores que 1,5 vezes a mediana são os “outliers”. 199

(229) Anexo Anexo 2 Produção científica gerada durante o doutorado Artigos publicados 1. de Souza Gomes, Matheus ; Muniyappa, Mohan Kumar ; Carvalho, Sávio Gonçalves ; Guerra-Sà , Renata ; Spillane, Charles . Genome-wide identification of novel microRNAs and their target genes in the human parasite Schistosoma mansoni. Genomics (San Diego, Calif.), v. 98, p. 96-111, 2011. 2. Pereira, Roberta Verciano ; Cabral, Fernanda J. ; Gomes, Matheus S. ; Baba, Elio H. ; Jannotti-Passos, Liana K. ; Carvalho, Omar ; Rodrigues, Vanderlei ; Afonso, Robson Josà Cà ssia Franco ; Castro-Borges, William ; Guerra-Sà , Renata . Molecular characterization of SUMO E2 conjugation enzyme: differential expression profile in Schistosoma mansoni. Parasitology Research (1987. Print), v. 109, p. 1537-1546, 2011. 3. Botelho-Machado, Carla ; Cabral, F. J. ; Soares, C. S. ; Moreira, E. B. C. ; Morais, E. R. ; Magalhães, L. G. ; Gomes, M. S. ; Guerra-Sá, R. ; Rosa, J. C. ; Ruller, R. ; Ward, R. J. ; RODRIGUES, V. . Characterization and mRNA expression analysis of PI31, an endogenous proteasome inhibitor from Schistosoma mansoni. Parasitology Research (1987. Print), v. 107, p. 1163-1171, 2010. 4. Gomes, Matheus S. ; Cabral, Fernanda J. ; Jannotti-Passos, Liana K. ; Carvalho, Omar ; Rodrigues, Vanderlei ; Baba, Elio H. ; Sá, Renata G. . Preliminary analysis of miRNA pathway in Schistosoma mansoni. Parasitology International, v. 58, p. 61-68, 2009. 5. Magalhães, Lizandra Guidi ; Castro-Borges, William ; Souza Gomes, Matheus ; Guerra-Sá, Renata ; Rodrigues, Vanderlei . Molecular cloning, sequencing, and expression analysis of presenilin cDNA from Schistosoma mansoni. Parasitology Research, v. 106, p. 713, 2009. 6. Paula, Fabiana M. ; Castro-Borges, William ; Júnior, Olavo S. Pereira ; Souza Gomes, Matheus ; Ueta, Marlene T. ; Rodrigues, Vanderlei . The ubiquitin proteasome system in Strongyloididae. Biochemical evidence for developmentally regulated proteolysis in Strongyloides venezuelensis. Parasitology Research, v. 105, p. 567-576, 2009. 7. VALENTIM, C. L. L. ; GOMES, M.S. ; Jeremias, W. J. ; Cunha, J. C. ; Oliveira, G. C. ; Botelho, A. C. C. ; Pimenta, P. F. P. ; Janotti-Passos, L. K. ; Guerra-Sá, R. ; Babá, E. H. . 200

(230) Anexo Physical Localization of the Retrotransposons Boudicca and Perere 03 in Schistosoma mansoni. The Journal of Parasitology, v. 94, p. 993, 2008. Artigos submetidos Matheus de Souza Gomes, Daniel Menezes Souza, Roenick Proveti Olmo, Liana K. Jannotti-Passos, Elio Hideo Babá, William Castro-Borges, Renata Guerra-Sá. “Evolutionarily conserved and developmentally-regulated expression of miRNA biogenesis and RISC complex components in Schistosoma mansoni”. Revista Gene – Julho 2011. Artigos em preparação Matheus de Souza Gomes, Mohan Kumar Muniyappa, Mark T. A. Donoghue, Roberta Verciano Pereira, Charles Spillane and Renata Guerra-Sá “Computational identification and evolution of microRNA gene cluster mir-71/2 in Protostomes”. Revista Journal of Molecular Evolution – Previsão de submissão Janeiro 2012. 201

(231)

Novo documento

Tags

Documento similar

O nível de correlação entre agilidade e velocidade em futebolistas depende da categoria competitiva
0
0
8
REPOSITORIO INSTITUCIONAL DA UFOP: Níveis plasmáticos de TNF-alfa, TRAIL e FasLigante/CD95L correlacionados com a disfunção ventricular em pacientes com cardiopatia chagásica crônica Ouro Preto 2008.
0
0
76
REPOSITORIO INSTITUCIONAL DA UFOP: Níveis de contaminantes inorgânicos em cachaças da região do quadrilátero ferrífero armazenadas em copos in natura de esteatito (pedra-sabão).
0
0
6
REPOSITORIO INSTITUCIONAL DA UFOP: Níveis de base fluviais : síntese dos principais condicionantes e dinâmica de instalação.
0
0
21
REPOSITORIO INSTITUCIONAL DA UFOP: Nitric oxide-mediated immune complex-induced prostaglandin E2 production by peripheral blood mononuclear cells of humans infected with Schistosoma mansoni.
0
0
6
UNIVERSIDADE FEDERAL DE OURO PRETO - UFOP INSTITUTO DE FILOSOFIA, ARTES E CULTURA Programa de Pós-Graduação em Filosofia
0
0
132
REPOSITORIO INSTITUCIONAL DA UFOP: Nickel–carbon nanocomposites prepared using castor oil as precursor : a novel catalyst for ethanol steam reforming.
0
0
5
REPOSITORIO INSTITUCIONAL DA UFOP: New evidence of Neoarchean crustal growth in southern São Francisco Craton : the Carmópolis de Minas Layered Suite, Minas Gerais, Brazil.
0
0
15
F. C. de Araújo - REPOSITORIO INSTITUCIONAL DA UFOP: New developments on BE/BE multi-zone algorithms based on krylov solvers - applications to 3D frequency-dependent problems.
0
0
18
PROGRAMA DE PÓS GRADUAÇÃO EM GEOTECNIA DA UFOP OURO PRETO – AGOSTO DE 2017
0
2
114
MODELAÇÃO FÍSICA DA DISPOSIÇÃO DE REJEITOS DE BAUXITA POR MEIO DE DIQUES-TESTES
0
0
138
REPOSITORIO INSTITUCIONAL DA UFOP: A moabilidade na moagem secundária de pellet-feeds de minérios de ferro em função da mineralogia, química e microestrutura.
0
0
73
REPOSITORIO INSTITUCIONAL DA UFOP: O “Mistério no Zoo” : um jogo para o ensino de zoologia de vertebrados no ensino fundamental II.
0
0
10
A MISSÃO GRACE E A ESTRUTURA DA LITOSFERA NA REGIÃO DO CRÁTON SÃO FRANCISCO
0
0
198
A MISÉRIA DA EDUCAÇÃO NA ORDEM DO CAPITAL
0
0
8
Show more