Feedback

The dual PI3K/mTOR inhibitor NVP-BEZ235 induces tumor regression in a genetically engineered mouse model of PIK3CA wild-type colorectal cancer.

 0  3  10  2017-02-01 13:37:04 Report infringing document
Documento informativo
The Dual PI3K/mTOR Inhibitor NVP-BEZ235 Induces Tumor Regression in a Genetically Engineered Mouse Model of PIK3CA Wild-Type Colorectal Cancer Jatin Roper1., Michael P. Richardson1., Wei Vivian Wang1, Larissa Georgeon Richard2, Wei Chen1, Erin M. Coffee1, Mark J. Sinnamon1, Lydia Lee1, Peng-Chieh Chen2, Roderick T. Bronson3, Eric S. Martin3, Kenneth E. Hung1* 1 Division of Gastroenterology, Department of Medicine, Tufts Medical Center, Boston, Massachusetts, United States of America, 2 Department of Genetics, Brigham and Women’s Hospital, Harvard Medical School, Boston, Massachusetts, United States of America, 3 Dana Farber/Harvard Cancer Center, Harvard Medical School, Boston, Massachusetts, United States of America Abstract Purpose: To examine the in vitro and in vivo efficacy of the dual PI3K/mTOR inhibitor NVP-BEZ235 in treatment of PIK3CA wild-type colorectal cancer (CRC). Experimental Design: PIK3CA mutant and wild-type human CRC cell lines were treated in vitro with NVP-BEZ235, and the resulting effects on proliferation, apoptosis, and signaling were assessed. Colonic tumors from a genetically engineered mouse (GEM) model for sporadic wild-type PIK3CA CRC were treated in vivo with NVP-BEZ235. The resulting effects on macroscopic tumor growth/regression, proliferation, apoptosis, angiogenesis, and signaling were examined. Results: In vitro treatment of CRC cell lines with NVP-BEZ235 resulted in transient PI3K blockade, sustained decreases in mTORC1/mTORC2 signaling, and a corresponding decrease in cell viability (median IC50 = 9.0–14.3 nM). Similar effects were seen in paired isogenic CRC cell lines that differed only in the presence or absence of an activating PIK3CA mutant allele. In vivo treatment of colonic tumor-bearing mice with NVP-BEZ235 resulted in transient PI3K inhibition and sustained blockade of mTORC1/mTORC2 signaling. Longitudinal tumor surveillance by optical colonoscopy demonstrated a 97% increase in tumor size in control mice (p = 0.01) vs. a 43% decrease (p = 0.008) in treated mice. Ex vivo analysis of the NVP-BEZ235treated tumors demonstrated a 56% decrease in proliferation (p = 0.003), no effects on apoptosis, and a 75% reduction in angiogenesis (p = 0.013). Conclusions: These studies provide the preclinical rationale for studies examining the efficacy of the dual PI3K/mTOR inhibitor NVP-BEZ235 in treatment of PIK3CA wild-type CRC. Citation: Roper J, Richardson MP, Wang WV, Richard LG, Chen W, et al. (2011) The Dual PI3K/mTOR Inhibitor NVP-BEZ235 Induces Tumor Regression in a Genetically Engineered Mouse Model of PIK3CA Wild-Type Colorectal Cancer. PLoS ONE 6(9): e25132. doi:10.1371/journal.pone.0025132 Editor: Alfons Navarro, University of Barcelona, Spain Received June 14, 2011; Accepted August 25, 2011; Published September 26, 2011 Copyright: ß 2011 Roper et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Funding: This study was supported by grants from the National Cancer Institute (2U01CA084301) and the National Institute of Diabetes and Digestive and Kidney Diseases (NIDDK)(5K08DK7803325, R03DK088014, and T32-DK07542). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Competing Interests: The authors have declared that no competing interests exist. * E-mail: khung@tuftsmedicalcenter.org . These authors contributed equally to this work. translation through phosphorylation of p70 S6 kinase (S6K), S6 ribosomal protein (S6), and eukaryotic initiation factor 4E binding protein 1(4E-BP1). Alternatively, mTOR can bind rapamycininsensitive companion of mTOR (Rictor), mLST8/GbL, and mammalian stress-activated protein kinase interacting protein 1 (mSIN1) to form mTOR complex 2 (mTORC2) [3,4]. The upstream phosphatidylinositol 3-kinase (PI3K) signaling pathway can activate mTOR. Class IA PI3Ks are activated by growth factor receptor tyrosine kinases (RTKs) and are composed of a heterodimer consisting of a p110a/p110b catalytic and a p85 regulatory subunit [5]. The PIK3CA (phosphatidylinositol 3-kinase, catalytic, a-polypeptide) gene that encodes p110a is frequently mutated in many human cancers, including CRC [6]. Point Introduction In 2011, colorectal cancer (CRC) will continue to be the third most common cause of cancer-related mortality in the U.S [1]. Despite the growing arsenal of chemotherapeutic agents, the median survival for patients with metastatic CRC is still less than 20 months, which underscores the urgent need for the development of novel therapeutic approaches [2]. Mammalian target of rapamycin (mTOR) is a serine/threonine kinase that regulates cellular proliferation and apoptosis. mTOR binds regulatory associated protein of mTOR (Raptor) and mammalian LST8/G-protein b-subunit like protein (mLST8/ GbL) to form the mTOR complex 1 (mTORC1), which promotes PLoS ONE | www.plosone.org 1 September 2011 | Volume 6 | Issue 9 | e25132 PI3K/mTOR Blockade in Colorectal Cancer initial densities (HCT116: 3,000 cells/well, DLD-1: 5,500 cells/ well, SW480: 4,500 cells/well, DLD-1 PIK3CA mutant: 7,000 cells/well, and DLD-1 PIK3CA wild-type: 9,000 cells/well) to account for differential growth kinetics. After 16 hours, cells were incubated with increasing concentrations of NVP-BEZ235 (Novartis), and drug-containing growth medium was changed every 24 hours. Cell viability was assessed 16 hours after the initial plating and 48 hours after initiation of drug treatment using the colorimetric MTS assay CellTiter 96H AQueous One Solution Cell Proliferation Assay (Promega), as per the manufacturer’s instructions. Cell viability after drug treatment was normalized to that of untreated cells also grown for 48 hours. IC50 values were calculated using 4 parameter nonlinear regression in GraphPad Prism 5 (GraphPad Software). For western blot analysis, cells were plated with 0 nM or maximal inhibitory dose (500 nM) NVPBEZ235 for 2, 6, 24, or 48 hours. mutations in PIK3CA cluster at two hotspots: E545K in the helical domain (exon 9) and H1047R in the catalytic kinase domain (exon 20). These mutations increase p110a activity and promote CRC cell growth, invasion, and migration in vitro via activation of the PI3K pathway [7]. Mutations in the helical and catalytic domains of PIK3CA confer essentially identical phenotypes in human CRC cell lines [7]. AKT is a critical downstream effector of the PI3K pathway and promotes cell growth and survival via a number of mechanisms, including phosphorylation of TSC2, which results in mTORC1 activation [5]. Full activation of AKT is achieved after phosphorylation at Thr308 and Ser473 by PDK1 and mTORC2, respectively [5,8–11]. Because of its central role in carcinogenesis, mTORC1 blockade is an attractive therapeutic strategy for CRC. Treatment of Apc D716 mice with the mTORC1 inhibitor everolimus inhibits cellular proliferation and tumor angiogenesis, resulting in a decrease in both number and size of intestinal tumors [12]. We have recently reported that treatment of a genetically engineered mouse (GEM) model for sporadic CRC with the mTORC1 inhibitor rapamycin results in an 80% reduction in individual tumor growth, as observed by longitudinal colonoscopy surveillance [11]. However, the clinical efficacy of mTORC1 blockade may be attenuated by the concomitant loss of an mTORC1dependent negative feedback loop on PI3K signaling (reflected by increased AKT phosphorylation at Thr308), and continued mTORC2-mediated activation of AKT through phosphorylation at Ser473 [9–14]. Indeed, a Phase I clinical trial examining the efficacy of the mTORC1 inhibitor everolimus in advanced solid tumors demonstrated modest benefit in only one of 16 colorectal cancer patients and overall increased phosphorylation of AKT at Ser473 [13]. Taken together, it appears that therapeutic strategies in which PI3K and mTOR are concurrently inhibited may be most efficacious. NVP-BEZ235 (Novartis) is a dual pan-class I PI3K and mTOR kinase inhibitor that has been demonstrated to reduce tumor growth in a number of different xenograft and several genetically engineered mouse (GEM) models and is currently in clinical trials [14–50]. There has been suggestion that use of such agents may be limited to tumors with activating mutations in PIK3CA [51,52]. As activating PIK3CA mutations are seen in only 17% of CRC, this would imply such agents may be targeted towards only a small proportion of patients [53]. Because NVP-BEZ235 inhibits the wild-type and mutant forms of PIK3CA with comparable efficacy [32], we hypothesized that NVP-BEZ235 may have significant efficacy in the treatment of PIK3CA wild-type CRC. In this manuscript, we describe results from in vitro treatment studies demonstrating comparable efficacy of NVP-BEZ235 against both PIK3CA mutant and wild-type human CRC cell lines. We also describe results from in vivo treatment studies demonstrating significant efficacy in a GEM model for sporadic wild-type PIK3CA CRC. Taken together, our findings provide a compelling preclinical rationale for clinical trials to examine the use of NVP-BEZ235 in treatment of PIK3CA wild-type CRC patients. Sequencing of colonic tumors from a GEM model for sporadic CRC C57BL/6J Apc conditional knockout mice (Apc CKO) were treated with Adeno-Cre, as previously described [11]. Following necropsy, 10 tumor specimens were collected in 1 ml RNA Later (Invitrogen, Inc), stored overnight in 4uC, then removed from RNA Later and archived in 280uC. RNA was extracted from specimens using RNeasy (Qiagen, Inc.), and cDNA was generated with reverse transcriptase (Omniscript RT, Qiagen, Inc). Primers designed by the study authors were used to create 553 bp and 477 bp amplicons (PCR performed using Platinum PCR SuperMix High Fidelity, Invitrogen, Inc) spanning codons 532–554 of exon 9 (helical domain; 9F: 59 GCAGTGTGGTGAAGTTTCCA 39, 9R: 59 TGGCCAATCCTTTGATTTGT 39) and c1011–1062 of exon 20 (kinase domain; 20F: 59 ACTGCGTGGCAACCTTTATC 39, 20R: 59 TGATGGTGTGGAAGATCCAA 39) of the Pik3ca gene, respectively, which include mutation hotspot regions. Sanger sequencing of the amplicons was performed at the BioPolymers Facility at Harvard Medical School, and results analyzed with Sequencher 4.10.1 (Gene Codes, Inc). In vivo treatment of a GEM model for sporadic CRC Apc CKO mice were treated with Adeno-Cre and followed by optical colonoscopy, as previously described [11]. As a colonoscopic metric for tumor size, the Tumor Size Index (TSI) was calculated as (tumor area/colonic lumen area)6100 (%). Tumorbearing mice were randomly assigned to treatment with either control vehicle alone (n = 8) or 45 mg/kg body weight NVPBEZ235 in 10% 1-methyl-2-pyrrolidone/90% PEG 300 (n = 8) by daily oral gavage for 28 days. The treatment dose was chosen based on literature indicating that 40–50 mg/kg body weight NVP-BEZ235 effectively treats murine tumor models without adverse effects [15,24,26,28,32,47]. Based on pharmacokinetic studies demonstrating maximal tissue concentration one hour after NVP-BEZ235 administration, tumor-bearing mice were sacrificed one hour after final treatment dose [32]. Colonic tumor volume was assessed using calipers (width6length6height) and tumors were harvested for both western blot analysis and immunohistochemistry. Materials and Methods In vitro treatment of human CRC cell lines Western blot analysis HCT116 (PIK3CA mutant; kinase domain at H1047R), DLD-1 (PIK3CA mutant; helical domain at E545K), and SW480 (PIK3CA wild-type) human CRC cell lines (ATCC) and isogenic DLD-1 PIK3CA mutant and wild-type cells (obtained from B. Vogelstein) were maintained in DMEM (Invitrogen) with 10% FBS and 16 Penicillin/Streptomycin (Invitrogen). Cells were plated at different PLoS ONE | www.plosone.org Concentrations of whole cell or tumor lysates were determined by Bio-Rad Protein Assay (Bio-Rad). 10 mg and 25 mg protein lysate for whole cell and tumor, respectively, was separated on 10% SDS/PAGE gel, transferred to nitrocellulose membrane, blocked in 1% BSA for one hour, incubated at room temperature 2 September 2011 | Volume 6 | Issue 9 | e25132 PI3K/mTOR Blockade in Colorectal Cancer for two hours with primary antibody and one hour with secondary antibody. Detection was performed using the AmershamTM ECLTM Western Blot Detection Reagents (GE Healthcare). pAKT Thr308 (1:1000 dilution), p-AKT Ser473 (1:2000 dilution), total AKT (1:1000 dilution), p-S6 Ser240/244 (1:3000 dilution), pS6 Ser235/236 (1:1000 dilution), S6 (1:1000 dilution), cleaved caspase 3 (1:1000 dilution), and cleaved PARP (1:1000 dilution) were obtained from Cell Signaling Technologies (Beverly, MA). bactin (1:5000 dilution) was obtained from Santa Cruz Biotechnology (Santa Cruz, CA). Peroxidase AffiniPure Donkey Anti- Rabbit Ig secondary antibody (1:10,000 dilution) was obtained from Jackson ImmunoResearch (West Grove, PA) [11]. three separate experiments = 14.366.4, 9.061.5, and 12.061.6 nM for HCT116, DLD-1, and SW480 cell lines, respectively; p = 0.74) for all three cell lines (Figure 1A). To determine if the observed decrease in cellular viability after NVP-BEZ235 treatment resulted from an induction of apoptosis, western blot analysis for cleaved caspase-3 and cleaved PARP was performed, revealing no increase in these apoptotic markers with NVP-BEZ235 treatment (Figure 1B). Taken together, these studies suggest that in vitro treatment with NVP-BEZ235 results in an equivalent decrease in cellular proliferation in two CRC cell lines harboring distinct PIK3CA mutations (HCT116 and DLD-1) as well as in a PIK3CA wild-type colorectal cancer cell (SW480), with no effect on apoptosis. Immunohistochemistry In vitro NVP-BEZ235 treatment of human CRC cell lines results in sustained mTORC1 and mTORC2 inhibition, but transient PI3K blockade Five mm paraffin-embedded tissue sections were deparaffinized in xylene followed by alcohol rehydration. Antigen retrieval was performed in 16 citrate buffer (pH 6.0) (Zymed) using a Medical Decloaking Chamber (Biocare Medical). Slides were blocked at room temperature with Peroxidase Blocking Reagent (DAKO), normal donkey/rabbit serum, and Avidin/Biotin Blocking Kit (Vector Laboratories). Slides were incubated overnight at 4uC with primary antibody and 30 minutes at room temperature with secondary antibody. The Vectastain ABC kit (Vector Laboratories) was used for detection per manufacturer’s instructions. Slides were stained with the Liquid DAB+Substrate Chromogen System (Dako) per manufacturer’s instructions and counterstained with Mayer’s hematoxylin solution and Scott’s Bluing solution. p-AKT Ser473 (1:50 dilution), p-S6 Ser240/244 (1:50 dilution), p-S6 Ser235/236 (1:100 dilution), were obtained from Cell Signaling Technologies (Beverly, MA). CD31 (1:100 dilution) was obtained from Santa Cruz Biotechnology (Santa Cruz, CA). KI-67 (1:100 dilution) was obtained from US Biological (Swampscott, MA). TUNEL assay (Apoptag) was purchased from Millipore (Billerica, MA) [11]. The KI-67 proliferation index was calculated as the mean number of KI-67 positive cells/total number of glandular cells per high power field (mean of 16 high power fields)6100, and microvessel density (MVD) was calculated as number of CD31 positive cells per high power field (mean of 16 high power fields). TUNEL positivity index was calculated as mean number of TUNEL positive cells/total number of glandular cells per high power field (mean of 16 high power fields)6100. Measurements were performed by three blinded, independent observers in four control and four treated tumors. To examine the effects of in vitro NVP-BEZ235 treatment on PI3K (p-AKTThr308), mTORC1 (p-S6Ser235/236 and p-S6Ser240/244), and mTORC2 (p-AKTSer473) mTOR signaling, western blot analysis was performed. After two hours of NVP-BEZ235 treatment, levels of p-AKTThr308, p-AKTSer473, p-S6Ser235/236, and p-S6Ser240/244 were all significantly decreased. Whereas a sustained decrease was observed in the levels of p-AKTSer473, pS6Ser235/236, and p-S6Ser240/244, full inhibition of p-AKTThr308 was lost in as little as six hours (Figure 1B). Taken together, these results suggest that in vitro NVP-BEZ235 treatment results in sustained inhibition of mTORC1 and mTORC2 signaling, but that PI3K blockade is transient. The efficacy of in vitro NVP-BEZ235 treatment of human CRC cell lines does not depend on PIK3CA mutational status The comparable efficacy of NVP-BEZ235 treatment in PIK3CA mutant (HCT116 and DLD-1) and PIK3CA wild type (SW480) human CRC cell lines suggests that its clinical efficacy might not be limited to those patients whose tumors contain activating PIK3CA mutations. To further examine this possibility, we assessed the effect of NVP-BEZ235 on cellular proliferation and intracellular cell signaling in paired PIK3CA mutant and wild-type cell lines. The PIK3CA mutant cell line was derived from DLD-1 through disruption of the wild-type PIK3CA allele by targeted homologous recombination, whereas the PIK3CA wildtype cell line was derived through disruption of the mutant PIK3CA allele (a kind gift from B. Vogelstein) [7]. As such, the genetic composition of these cells differs only at the PIK3CA locus, making these otherwise perfect isogenic controls. We found similar IC50’s for NVP-BEZ235 in both PIK3CA mutant and wild-type DLD-1 cells (mean IC50 of three separate experiments = 15.166.0 and 12.164.3 nM for DLD-1 PIK3CA mutant and wild-type cell lines, respectively; p = 0.82, Figure 2A). Western blot analysis of p-AKT and p-S6 revealed sustained inhibition of p-AKTSer473, p-S6Ser235/236, and p-S6Ser240/244; however, the inhibition of p-AKTThr308 was transient in both cell lines (Figure 2B). Furthermore, NVP-BEZ235 treatment did not increase levels of cleaved caspase-3 and cleaved equilibrium value of MeCpG steps (,+14 deg.) [31,44]. In comparison, methylation has a significantly lower stability cost when happening at major groove positions, such as 211 and 21 base pair from dyad (mutations 9 and 12), where the roll of the nucleosome bound conformation (+10 deg.) is more compatible with the equilibrium geometry of MeCpG steps. The nucleosome destabilizing effect of cytosine methylation increases with the number of methylated cytosines, following the same position dependence as the single methylations. The multiple-methylation case reveals that each major groove meth- PLOS Computational Biology | www.ploscompbiol.org 3 November 2013 | Volume 9 | Issue 11 | e1003354 DNA Methylation and Nucleosome Positioning ylation destabilizes the nucleosome by around 1 kJ/mol (close to the average estimate of 2 kJ/mol obtained for from individual methylation studies), while each minor groove methylation destabilizes it by up to 5 kJ/mol (average free energy as single mutation is around 6 kJ/mol). This energetic position-dependence is the reverse of what was observed in a recent FRET/SAXS study [30]. The differences can be attributed to the use of different ionic conditions and different sequences: a modified Widom-601 sequence of 157 bp, which already contains multiple CpG steps in mixed orientations, and which could assume different positioning due to the introduction of new CpG steps and by effect of the methylation. The analysis of our trajectories reveals a larger root mean square deviation (RMSD) and fluctuation (RMSF; see Figures S2– S3 in Text S1) for the methylated nucleosomes, but failed to detect any systematic change in DNA geometry or in intermolecular DNA-histone energy related to methylation (Fig. S1B, S1C, S4–S6 in Text S1). The hydrophobic effect should favor orientation of the methyl group out from the solvent but this effect alone is not likely to justify the positional dependent stability changes in Figure 2, as the differential solvation of the methyl groups in the bound and unbound states is only in the order of a fraction of a water molecule (Figure S5 in Text S1). We find however, a reasonable correlation between methylation-induced changes in hydrogen bond and stacking interactions of the bases and the change in nucleosome stability (see Figure S6 in Text S1). This finding suggests that methylation-induced nucleosome destabilization is related to the poorer ability of methylated DNA to fit into the required conformation for DNA in a nucleosome. Changes in the elastic deformation energy between methylated and un-methylated DNA correlate with nucleosomal differential binding free energies To further analyze the idea that methylation-induced nucleosome destabilization is connected to a worse fit of methylated DNA into the required nucleosome-bound conformation, we computed the elastic energy of the nucleosomal DNA using a harmonic deformation method [36,37,44]. This method provides a rough estimate of the energy required to deform a DNA fiber to adopt the super helical conformation in the nucleosome (full details in Suppl. Information Text S1). As shown in Figure 2, there is an evident correlation between the increase that methylation produces in the elastic deformation energy (DDE def.) and the free energy variation (DDG bind.) computed from MD/TI calculations. Clearly, methylation increases the stiffness of the CpG step [31], raising the energy cost required to wrap DNA around the histone octamers. This extra energy cost will be smaller in regions of high positive roll (naked DNA MeCpG steps have a higher roll than CpG steps [31]) than in regions of high negative roll. Thus, simple elastic considerations explain why methylation is better tolerated when the DNA faces the histones through the major groove (where positive roll is required) that when it faces histones through the minor groove (where negative roll is required). Nucleosome methylation can give rise to nucleosome repositioning We have established that methylation affects the wrapping of DNA in nucleosomes, but how does this translate into chromatin structure? As noted above, accumulation of minor groove methylations strongly destabilizes the nucleosome, and could trigger nucleosome unfolding, or notable changes in positioning or phasing of DNA around the histone core. While accumulation of methylations might be well tolerated if placed in favorable positions, accumulation in unfavorable positions would destabilize the nucleosome, which might trigger changes in chromatin structure. Chromatin could in fact react in two different ways in response to significant levels of methylation in unfavorable positions: i) the DNA could either detach from the histone core, leading to nucleosome eviction or nucleosome repositioning, or ii) the DNA could rotate around the histone core, changing its phase to place MeCpG steps in favorable positions. Both effects are anticipated to alter DNA accessibility and impact gene expression regulation. The sub-microsecond time scale of our MD trajectories of methylated DNAs bound to nucleosomes is not large enough to capture these effects, but clear trends are visible in cases of multiple mutations occurring in unfavorable positions, where unmethylated and methylated DNA sequences are out of phase by around 28 degrees (Figure S7 in Text S1). Due to this repositioning, large or small, DNA could move and the nucleosome structure could assume a more compact and distorted conformation, as detected by Lee and Lee [29], or a slightly open conformation as found in Jimenez-Useche et al. [30]. Using the harmonic deformation method, we additionally predicted the change in stability induced by cytosine methylation for millions of different nucleosomal DNA sequences. Consistently with our calculations, we used two extreme scenarios to prepare our DNA sequences (see Fig. 3): i) all positions where the minor grooves contact the histone core are occupied by CpG steps, and ii) all positions where the major grooves contact the histone core are occupied by CpG steps. We then computed the elastic energy required to wrap the DNA around the histone proteins in unmethylated and methylated states, and, as expected, observed that methylation disfavors DNA wrapping (Figure 3A). We have rescaled the elastic energy differences with a factor of 0.23 to match the DDG prediction in figure 2B. In agreement with the rest of our results, our analysis confirms that the effect of methylation is position-dependent. In fact, the overall difference between the two extreme methylation scenarios (all-in-minor vs all-in-major) is larger than 60 kJ/mol, the average difference being around 15 kJ/ mol. We have also computed the elastic energy differences for a million sequences with CpG/MeCpG steps positioned at all possible intermediate locations with respect to the position (figure 3B). The large differences between the extreme cases can induce rotations of DNA around the histone core, shifting its phase to allow the placement of the methylated CpG steps facing the histones through the major groove. It is illustrative to compare the magnitude of CpG methylation penalty with sequence dependent differences. Since there are roughly 1.5e88 possible 147 base pairs long sequence combinations (i.e., (4n+4(n/2))/2, n = 147), it is unfeasible to calculate all the possible sequence effects. However, using our elastic model we can provide a range of values based on a reasonably large number of samples. If we consider all possible nucleosomal sequences in the yeast genome (around 12 Mbp), the energy difference between the best and the worst sequence that could form a nucleosome is 0.7 kj/mol per base (a minimum of 1 kJ/mol and maximum of around 1.7 kJ/mol per base, the first best and the last worst sequences are displayed in Table S3 in Text S1). We repeated the same calculation for one million random sequences and we obtained equivalent results. Placing one CpG step every helical turn gives an average energetic difference between minor groove and major groove methylation of 15 kJ/ mol, which translates into ,0.5 kJ/mol per methyl group, 2 kJ/ mol per base for the largest effects. Considering that not all nucleosome base pair steps are likely to be CpG steps, we can conclude that the balance between the destabilization due to CpG methylation and sequence repositioning will depend on the PLOS Computational Biology | www.ploscompbiol.org 4 November 2013 | Volume 9 | Issue 11 | e1003354 DNA Methylation and Nucleosome Positioning Figure 3. Methylated and non-methylated DNA elastic deformation energies. (A) Distribution of deformation energies for 147 bplong random DNA sequences with CpG steps positioned every 10 base steps (one helical turn) in minor (red and dark red) and major (light and dark blue) grooves respectively. The energy values were rescaled by the slope of a best-fit straight line of figure 2, which is 0.23, to por la lectura a través de la lectura de la prensa. La educación en los medios las fuerzas dispersas en función de los soportes mediáticos y orientarse más hacia la educación en medios que al dominio adquiere pleno derecho y entidad en la sección sexta titulada «competencias sociales y cívi- técnico de los aparatos. cas» que indica que «los alum- nos deberán ser capaces de juz- gar y tendrán espíritu crítico, lo que supone ser educados en los las programaciones oficiales, ya que, a lo largo de un medios y tener conciencia de su lugar y de su influencia estudio de los textos, los documentalistas del CLEMI en la sociedad». han podido señalar más de una centena de referencias a la educación de los medios en el seno de disciplinas 4. Un entorno positivo como el francés, la historia, la geografía, las lenguas, Si nos atenemos a las cifras, el panorama de la las artes plásticas : trabajos sobre las portadas de educación en medios es muy positivo. Una gran ope- prensa, reflexiones sobre temas mediáticos, análisis de ración de visibilidad como la «Semana de la prensa y publicidad, análisis de imágenes desde todos los ángu- de los medios en la escuela», coordinada por el CLE- los, reflexión sobre las noticias en los países europeos, MI, confirma año tras año, después de 17 convocato- información y opinión rias, el atractivo que ejerce sobre los profesores y los Esta presencia se constata desde la escuela mater- alumnos. Concebida como una gran operación de nal (2 a 6 años) donde, por ejemplo, se le pregunta a complementariedad entre la escuela y los profesiona- los niños más pequeños si saben diferenciar entre un les de los medios, alrededor del aprendizaje ciudada- periódico, un libro, un catálogo, a través de activida- no de la comunicación mediática, este evento moviliza des sensoriales, si saben para qué sirve un cartel, un durante toda una semana un porcentaje elevado de periódico, un cuaderno, un ordenador si son capa- centros escolares que representan un potencial de 4,3 ces de reconocer y distinguir imágenes de origen y de millones de alumnos (cifras de 2006). Basada en el naturaleza distintas. Podríamos continuar con más voluntariado, la semana permite desarrollar activida- ejemplos en todos los niveles de enseñanza y práctica- des más o menos ambiciosas centradas en la introduc- Páginas 43-48 ción de los medios en la vida de la escuela a través de la instalación de kioscos, organización de debates con profesionales y la confección por parte de los alumnos de documentos difundidos en los medios profesionales. Es la ocasión de dar un empujón a la educación en medios y de disfrutarlos. Los medios –un millar en 2006– se asocian de maneras diversas ofreciendo ejemplares de periódicos, acceso a noticias o a imágenes, proponiendo encuentros, permitiendo intervenir a los jóvenes en sus ondas o en sus columnas Esta operación da luz al trabajo de la educación en medios y moviliza a los diferentes participantes en el proyecto. 5. La formación de los docentes La formación es uno de los pilares principales de la educación en los medios. Su función es indispensable ya que no se trata de una disciplina, sino de una enseñanza que se hace sobre la base del voluntariado y del compromiso personal. Se trata de convencer, de mostrar, de interactuar. En primer lugar es necesario incluirla en la formación continua de los docentes, cuyo volumen se ha incrementado desde 1981 con la aparición de una verdadera política de formación continua de personal. Es difícil dar una imagen completa del volumen y del público, pero si nos atenemos a las cifras del CLEMI, hay más de 24.000 profesores que han asistido y se han involucrado durante 2004-05. 5.1. La formación continua En la mayoría de los casos, los profesores reciben su formación en contextos cercanos a su centro de trabajo, o incluso en este mismo. Después de una política centrada en la oferta que hacían los formadores, se valora más positivamente la demanda por parte del profesorado, ya que sólo así será verdaderamente fructífera. Los cursos de formación se repartieron en varias categorías: desde los formatos más tradicionales (cursos, debates, animaciones), hasta actividades de asesoramiento y de acompañamiento, y por supuesto los coloquios que permiten un trabajo en profundidad ya que van acompañados de expertos investigadores y profesionales. Citemos, por ejemplo en 2005, los coloquios del CLEMI-Toulouse sobre el cine documental o el del CLEMI-Dijon sobre «Políticos y medios: ¿connivencia?». Estos coloquios, que forman parte de un trabajo pedagógico regular, reagrupan a los diferentes participantes regionales y nacionales alrededor de grandes temas de la educación en medios y permiten generar nuevos conocimientos de aproximación y una profundización. Páginas 43-48 Hay otro tipo de formación original que se viene desarrollando desde hace menos tiempo, a través de cursos profesionales, como por ejemplo, en el Festival Internacional de Foto-periodismo «Visa para la imagen», en Perpignan. La formación se consolida en el curso, da acceso a las exposiciones, a las conferencias de profesionales y a los grandes debates, pero añade además propuestas pedagógicas y reflexiones didácticas destinadas a los docentes. Estas nuevas modalidades de formación son también consecuencia del agotamiento de la formación tradicional en las regiones. Los contenidos más frecuentes en formación continua conciernen tanto a los temas más clásicos como a los cambios que se están llevando a cabo en las prácticas mediáticas. Así encontramos distintas tendencias para 2004-05: La imagen desde el ángulo de la producción de imágenes animadas, el análisis de la imagen de la información o las imágenes del J.T. La prensa escrita y el periódico escolar. Internet y la información en línea. Medios y educación de los medios. 5.2 La formación inicial La formación inicial está aun en un grado muy ini- cial. El hecho de que la educación en medios no sea una disciplina impide su presencia en los IUFM (Institutos Universitarios de Formación de Maestros) que dan una prioridad absoluta a la didáctica de las disciplinas. En 2003, alrededor de 1.400 cursillistas sobre un total de 30.000 participaron en un momento u otro de un módulo de educación en medios. Estos módulos se ofrecen en función del interés que ese formador encuentra puntualmente y forman parte a menudo de varias disciplinas: documentación, letras, historia-geografía Estamos aún lejos de una política concertada en este dominio. La optativa «Cine-audiovisual» ha entrado desde hace muy poco tiempo en algunos IUFM destinada a obtener un certificado de enseñanza de la opción audiovisual y cine. Internet tiene cabida también en los cursos de formación inicial, recientemente con la aparición de un certificado informático y de Internet para los docentes, dirigido más a constatar competencias personales que a valorar una aptitud para enseñarlos. 6. ¿Y el futuro? El problema del futuro se plantea una vez más por la irrupción de nuevas técnicas y nuevos soportes. La difusión acelerada de lo digital replantea hoy muchas cuestiones relativas a prácticas mediáticas. Muchos Comunicar, 28, 2007 47 Comunicar, 28, 2007 Enrique Martínez-Salanova '2007 para Comunicar 48 trabajos que llevan el rótulo de la educación en medios solicitan una revisión ya que los conceptos cambian. La metodología elaborada en el marco de la educación en medios parece incluso permitir la inclinación de la sociedad de la información hacia una sociedad del conocimiento, como defiende la UNESCO. En Francia, se necesitaría unir las fuerzas dispersas en función de los soportes mediáticos y orientarse más hacia la educación en medios que al dominio técnico de los aparatos. Los avances recientes en el reconocimiento de estos contenidos y las competencias que supondrían podrían permitirlo. Referencias CLEMI/ACADEMIE DE BORDEAUX (Ed.) (2003): Parcours médias au collège: approches disciplinaires et transdisciplinaires. Aquitaine, Sceren-CRDP. GONNET, J. (2001): Education aux médias. Les controverses fécondes. Paris, Hachette Education/CNDP. SAVINO, J.; MARMIESSE, C. et BENSA, F. (2005): L’éducation aux médias de la maternelle au lycée. Direction de l’Enseignement Scolaire. Paris, Ministère de l’Education Nationale, Sceren/CNDP, Témoigner. BEVORT, E. et FREMONT, P. (2001): Médias, violence et education. Paris, CNDP, Actes et rapports pour l’éducation. – www.clemi.org: fiches pédagogiques, rapports et liens avec les pages régionales/académiques. – www.ac-nancy-metz.fr/cinemav/quai.html: Le site «Quai des images» est dédié à l’enseignement du cinéma et de l’audiovisuel. – www.france5.fr/education: la rubrique «Côté profs» a une entrée «education aux médias». – www.educaunet.org: Programme européen d’éducation aux risques liés à Internet. dResedfeleexliobnuetsacón Páginas 43-48
The dual PI3K/mTOR inhibitor NVP-BEZ235 induces tumor regression in a genetically engineered mouse model of PIK3CA wild-type colorectal cancer.
RECENT ACTIVITIES
Autor
Documento similar
Tags

The dual PI3K/mTOR inhibitor NVP-BEZ235 induces tumor regression in a genetically engineered mouse model of PIK3CA wild-type colorectal cancer.

Livre