Feedback

Proteomic Identification of Oxidized Proteins in Entamoeba histolytica by Resin-Assisted Capture: Insights into the Role of Arginase in Resistance to Oxidative Stress.

Documento informativo
RESEARCH ARTICLE Proteomic Identification of Oxidized Proteins in Entamoeba histolytica by Resin-Assisted Capture: Insights into the Role of Arginase in Resistance to Oxidative Stress Preeti Shahi1, Meirav Trebicz-Geffen1, Shruti Nagaraja1, Sharon Alterzon-Baumel1, Rivka Hertz1, Karen Methling2, Michael Lalk2, Serge Ankri1* 1 Department of Molecular Microbiology, Bruce Rappaport Faculty of Medicine, Technion-Israel Institute of Technology, Haifa, Israel, 2 University of Greifswald, Institute of Biochemistry, Greifswald, Germany * sankri@tx.technion.ac.il Abstract OPEN ACCESS Citation: Shahi P, Trebicz-Geffen M, Nagaraja S, Alterzon-Baumel S, Hertz R, Methling K, et al. (2016) Proteomic Identification of Oxidized Proteins in Entamoeba histolytica by Resin-Assisted Capture: Insights into the Role of Arginase in Resistance to Oxidative Stress. PLoS Negl Trop Dis 10(1): e0004340. doi:10.1371/journal.pntd.0004340 Editor: Alvaro Acosta-Serrano, Liverpool School of Tropical Medicine, UNITED KINGDOM Received: August 18, 2015 Accepted: December 8, 2015 Published: January 6, 2016 Copyright: © 2016 Shahi et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Data Availability Statement: All relevant data are within the paper and its Supporting Information files. Funding: This study was supported by grants from the German Research Foundation (DFG) (AN 784/12), Israel Science Foundation (ISF) (1218/10), the Israel Ministry of Health and the German Ministry of Education and Science BMBF within the framework ERA-NET Infect-ERA (031L0004) (AMOEBAC project). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Entamoeba histolytica is an obligate protozoan parasite of humans, and amebiasis, an infectious disease which targets the intestine and/or liver, is the second most common cause of human death due to a protozoan after malaria. Although amebiasis is usually asymptomatic, E. histolytica has potent pathogenic potential. During host infection, the parasite is exposed to reactive oxygen species that are produced and released by cells of the innate immune system at the site of infection. The ability of the parasite to survive oxidative stress (OS) is essential for a successful invasion of the host. Although the effects of OS on the regulation of gene expression in E. histolytica and the characterization of some proteins whose function in the parasite's defense against OS have been previously studied, our knowledge of oxidized proteins in E. histolytica is lacking. In order to fill this knowledge gap, we performed a large-scale identification and quantification of the oxidized proteins in oxidatively stressed E. histolytica trophozoites using resin-assisted capture coupled to mass spectrometry. We detected 154 oxidized proteins (OXs) and the functions of some of these proteins were associated with antioxidant activity, maintaining the parasite's cytoskeleton, translation, catalysis, and transport. We also found that oxidation of the Gal/GalNAc impairs its function and contributes to the inhibition of E. histolytica adherence to host cells. We also provide evidence that arginase, an enzyme which converts L-arginine into L-ornithine and urea, is involved in the protection of the parasite against OS. Collectively, these results emphasize the importance of OS as a critical regulator of E. histolytica's functions and indicate a new role for arginase in E. histolytica's resistance to OS. Author Summary Reactive oxygen species are the most studied of environmental stresses generated by the host immune defense against pathogens. Although most of the studies that have PLOS Neglected Tropical Diseases | DOI:10.1371/journal.pntd.0004340 January 6, 2016 1 / 21 Arginase Mediated Resistance to Oxidative Stress in Entamoeba Competing Interests: The authors have declared that no competing interests exist. investigated the effect of oxidative stress on an organism have focused on changes which occur at the protein level, only a few studies have investigated the oxidation status of these proteins. Infection with Entamoeba histolytica is known as amebiasis. This condition occurs worldwide, but is most associated with crowded living conditions and poor sanitation. The parasite is exposed inside the host to oxidative stress generated by cells of the host immune system. The nature of oxidized proteins in oxidatively stressed E. histolytica has never been studied. In this report, the authors present their quantitative results of a proteome-wide analysis of oxidized proteins in the oxidatively stressed parasite. They identified crucial redox-regulated proteins that are linked to the virulence of the parasite, such as the Gal/GalNAc lectin. They also discovered that arginase, a protein involved in ornithine synthesis, is also involved in the parasite's resistance to oxidative stress. Introduction Amebiasis is a parasitic infection of the intestines and is mainly caused by fecal contamination [1]. Although 90% of infected individuals are asymptomatic, amebic dysentery affects 50 million people in India, Southeast Asia, Africa, and Latin America and amebiasis is the cause of at least 100,000 deaths each year [2, 3]. Following excystation within the small intestinal lumen, trophozoites colonize the large intestine and they usually reside in the colon as a non-pathogenic commensal in most infected individuals. Due to as yet unidentified causes, these trophozoites can cause amebic dysentery, become virulent and invasive, and migrate to the liver, via the portal veins, where they cause hepatocellular damage. Following host invasion, invading E. histolytica trophozoites are challenged by oxidative stress (OS) and nitrosative stress (NS), which originate from fluctuations in ambient oxygen tension in the intestinal lumen and the generation of reactive oxygen species (ROS) and reactive nitrogen species (RNS) by cells of the immune system. Once formed, these reactive species can oxidatively damage proteins and change their structural conformation and functional activity [4], [5], [6]. The parasite's complex response to OS involves modulation of a large number of genes which encode proteins that are associated with signaling/regulatory and repair/ metabolic pathways and proteins whose exact functions are still unknown [7]. It has been recently reported that the expression of these genes is regulated by a recently identified transcription factor that binds to a specific promoter motif of hydrogen peroxide (H2O2)-responsive genes [8]. It has also been reported that those genes in E. histolytica which confer resistance to OS also contribute to its virulence [9]. Since antioxidant enzymes, such as catalase, glutathione reductase, and γ-glutamyl transpeptidase, are missing from E. histolytica's enzyme resource [10], one of the functions of proteins, such as the 29-kDa peroxiredoxin [11] and the iron-containing peroxide dismutase [12], is to protect the parasite against OS. Since OS glycolysis is inhibited and metabolic flux is redirected towards glycerol production in oxidatively stressed E. histolytica trophozoites, these findings suggest that the glycerol synthesis pathway is a component of the parasite's metabolic antioxidative defense system [13]. Despite these informative data on the parasite's response to OS, our knowledge on the identity of oxidized proteins in E. histolytica is still incomplete. Here, we report the results of a study whose aim was to identify and to determine the biological relevance of oxidized proteins (OX) in E. histolytica using resin-assisted capture (RAC) coupled with mass spectrometry (MS) [14]. The results of this analysis revealed 154 OXs which include antioxidant proteins, cytoskeleton proteins, protein involved in translation, and transport proteins. We also found that oxidation of cysteine residues in the carbohydrate recognition domain (CRD) of the 260-kD PLOS Neglected Tropical Diseases | DOI:10.1371/journal.pntd.0004340 January 6, 2016 2 / 21 Arginase Mediated Resistance to Oxidative Stress in Entamoeba heterodimer and multifunctional virulence factor of E.histolytica, Gal/GalNAc lectin (gl), impairs its ability to adhere to host cells. We also found that arginase, the enzyme which converts L-arginine into L-ornithine and urea, confers resistance to OS in E.histolytica. Methods Microorganisms E. histolytica trophozoites strain HM-1:IMSS were grown under axenic conditions in Diamond's TYI S-33 medium at 37°C. Trophozoites in the exponential phase of growth were used in all experiments. DNA constructs For the construction of the pJST4-arginase expression vector, arginase was amplified by polymerase chain reaction (PCR) using the primers, Arginase KpnI and Arginase BglII (table 1). The PCR product was subcloned using the pGEM-T Easy vector system (Promega) and then digested with the restriction enzymes KpnI and Bgl II. The digested DNA insert was cloned into the E. histolytica expression vector pJST4 which had been previously linearized with KpnI and Bgl II. The pJST4 expression vector (pcontrol) contains a tandem affinity purification tag for use in protein purification and identification [15]. This CHH-tag contains the calmodulin binding protein, hemagglutinin (HA), and histidine (His) residues and its expression is driven by an actin promoter. This vector was used as control in our experiment in order to exclude the possibility that the CHH tag is responsible for the phenotypes of the arginase-overexpressing strain. A previously described protocol was used to transfect E. histolytica trophozoites [16]. Viability assay E. histolytica trophozoites (1x106) were exposed to 1 mM, 2.5 mM, 5 mM, 7 mM, or 10 mM H2O2 for 60 minutes at 37°C. At the end of the exposure, a 10-μl aliquot of each culture was stained with eosin (0.1% final concentration), and the number of living trophozoites was counted in a counting chamber under a light microscope. Resistance of the control, trophozoites overexpressing arginase and pcontrol trophozoites to OS was measured by calculating the median lethal dose (LD50) of hydrogen peroxide (H2O2) by linear regression analysis using Microsoft Excel. The assay was repeated three times with two replicates in each assay. Determination of intracellular ROS levels Control and oxidatively stressed E. histolytica trophozoites were incubated with 0.4 mM (final concentration) 2,7-dichlorofluorescein diacetate (H2DCFDA; Sigma) for 15 minutes in the dark. The cells were washed twice in phosphate buffered saline (PBS; pH 7.4) and immediately examined under a Zeiss Axio Scope.A1 fluorescence microscope. Intracellular ROS levels were determined by measuring fluorescence intensity using the ImageJ software [17]. Table 1. Oligonucleotides used in this study. Primer Name Sequence Direction Restriction site-underline Arginase Kpn1 GGTACCATGCAATTTGAAAAAGTTA Sense KpnI Arginase Bgl11 AGATCTACACTTTATACCAAAAAGTG Antisense BglII doi:10.1371/journal.pntd.0004340.t001 PLOS Neglected Tropical Diseases | DOI:10.1371/journal.pntd.0004340 January 6, 2016 3 / 21 Arginase Mediated Resistance to Oxidative Stress in Entamoeba Detection of OXs by OX-RAC E. histolytica trophozoites (5x107) were incubated with 2.5 mM H2O2 for 60 minutes at 37°C. At the end of the incubation, a total protein extract was prepared by lysing the oxidatively stressed trophozoites with 1% Igepal (Sigma) in PBS. OXs in the extract were detected by OX-RAC using a previously described protocol [14] with minor modifications. Briefly, the total protein extract (9 mg) was incubated in mixture of 50 mM N-ethylmaleimide and 2.5% sodium dodecyl sulfate (SDS) for one hour at 50°C with frequent vortexing in order to block the free thiols. The proteins were then precipitated with three volumes of cold 100% acetone and incubated at -20°C for 20 minutes. The mixture was centrifuged at 1820g for five minutes, and the pellet was then washed three times with 70% acetone (3 volumes) and then resuspended in HENS buffer which contains 100 mM HEPES, 1 mM EDTA, 0.1 mM neocuproine, and 1% SDS). The resuspended samples were added to 80 μl thiopropyl sepharose 6B resin (GE Healthcare) in the presence or absence of dithiothreitol (DTT, final concentration 10 mM). DTT is a reducing agent, which enables the oxidized thiol group of cysteine to bind to the resin by forming disulfide bonds between the reduced thiol groups of the proteins and the thiol group of the resin. The samples were rotated in the dark at room temperature for 1–2 hours, and then overnight at 4°C. The resin was washed four times with 1 ml HENS buffer, and then twice with 1 ml HENS/10 buffer (1:10 HENS buffer). Captured proteins were eluted with 30 μl HENS/10 buffer which contained 100 mM 2-mercaptoethanol for 20 minutes at room temperature, and the proteins in each eluent were resolved on a 12.5% SDS-PAGE gel. Each gel was then stained with silver (Pierce Silver Stain) and each gel slice was independently analyzed by MS. In-gel proteolysis for MS-based protein identification The proteins in each gel slice were reduced with 2.8 mM DTT (60°C for 30 minutes), modified with 8.8 mM iodoacetamide in 100mM ammonium bicarbonate in the dark at room temperature for 30 minutes, and digested overnight in 10% acetonitrile and 10 mM ammonium bicarbonate with modified trypsin (Promega-Biological Industries, Israel) at 37°C. The resulting peptides were resolved by reverse-phase chromatography on 0.075 x 200-mm fused silica capillaries (J&W Scientific, Agilent Technologies, Israel) packed with Reprosil reversed phase material (Dr. Maisch GmbH, Germany). The peptides were eluted at flow rates of 0.25 μl/min on linear gradients of 7–40% acetonitrile in 0.1% formic acid for 95 minutes followed by eight minutes at 95% acetonitrile in 0.1% formic acid. MS was done by an ion-trap mass spectrometer (Orbitrap, Thermo) in a positive mode using a repetitively full MS scan followed by collision-induced dissociation (CID) of the seven most dominant ions selected from the first MS scan. The MS data was analyzed using the Proteome Discoverer software version 1.3 which searches the Ameba section of the NCBI-NR database and the decoy databases (in order to determine the false discovery rate (FDR)) using the Sequest and the Mascot search engines. Classification of OXs according to their protein class The OXs were classified according to their protein class using the PANTHER software (Protein ANalysis THrough Evolutionary Relationships) Classification System (http://www.pantherdb. org/) [18]. Adhesion assay The adhesion of oxidatively stressed trophozoites to HeLa cell monolayers was measured using a previously described protocol [19]. Briefly, trophozoites (2×105) were exposed to 2.5 mM PLOS Neglected Tropical Diseases | DOI:10.1371/journal.pntd.0004340 January 6, 2016 4 / 21 Arginase Mediated Resistance to Oxidative Stress in Entamoeba H2O2 for 20 minutes at 37°C, washed twice with Dulbecco's modified Eagle's medium (DMEM) without serum, added to wells that contained fixed HeLa monolayers in 1 ml of DMEM without serum, and incubated for 30 minutes at 37°C. The number of adherent trophozoites was determined by counting the number of trophozoites that remained attached to the HeLa cells after gentle decanting (twice) of the non-adherent trophozoites with warm (37°C) DMEM under a light microscope. Determination of E. histolytica motility The Costar Transwell System (8-μm pore size polycarbonate membrane, 6.5-mm diameter, Corning Inc, Corning, NY, USA) was used to determine trophozoite motility [20]. Briefly, 24-well culture plate was filled with serum-free Diamond’s TYI-S-33 medium (500-μl per well). A transwell insert was then inserted into each well. Control and oxidatively stressed (2.5 mM and 1 mM for one hour at 37°C) trophozoites were washed three times in serum-free Diamond’s TYI-S-33 medium, and then suspended in serum-free Diamond’s TYI-S-33 medium. A 500-μl aliquot of the suspension (26x105 trophozoites/ml) was then loaded into the transwell inserts. The 24-well culture plate containing the transwell inserts was then placed in anaerobic bags (Mitsubishi Gas Chemical Company, Inc., Tokyo, Japan), and incubated for three hours at 37°C. At the end of the incubation, the inserts and culture medium were removed from the 24-well culture plate, and trophozoite migration was determined by counting the number of trophozoites that were attached to the bottom of the wells of the 24-well culture plate. Purification of Gal/GalNAc lectin by affinity chromatography Gal/GalNAc lectin was purified using a previously described protocol [21] Oxidation of purified Gal/GalNAc lectin Aliquots (5 μg) of purified Gal/GalNAc lectin were incubated with either 0.1 mM or 2.5 mM H2O2 for ten minutes at 37°C. The Gal/GalNAc lectin was then incubated with 10 μl D-galactose-coated agarose beads (Thermo Scientific-Pierce) overnight at 4°C. At the end of the incubation, the beads were washed in 20 volumes of PBS and then boiled in Laemmli sample buffer. The amount of Gal/GalNAc lectin that was released from the beads was determined using SDS-PAGE gel electrophoresis and silver staining (Pierce). Detection of oxidized Gal/GalNac lectin Aliquots (5 μg) of purified Gal/GalNac lectin [21] were treated with 1 mM H2O2 for ten minutes at room temperature in order to introduce carbonyl groups into protein side chains. Using the OxyBlot Protein Oxidation Detection Kit (Millipore, Israel) [22], the carbonyl groups are derivatized with 2,4-dinitrophenylhydrazine (DNPH). The DNPH-treated Gal/GalNac lectin was separated by SDS-PAGE, transferred onto a nitrocellulose membrane and then detected by a specific antibody against the equilibrium value of MeCpG steps (,+14 deg.) [31,44]. In comparison, methylation has a significantly lower stability cost when happening at major groove positions, such as 211 and 21 base pair from dyad (mutations 9 and 12), where the roll of the nucleosome bound conformation (+10 deg.) is more compatible with the equilibrium geometry of MeCpG steps. The nucleosome destabilizing effect of cytosine methylation increases with the number of methylated cytosines, following the same position dependence as the single methylations. The multiple-methylation case reveals that each major groove meth- PLOS Computational Biology | www.ploscompbiol.org 3 November 2013 | Volume 9 | Issue 11 | e1003354 DNA Methylation and Nucleosome Positioning ylation destabilizes the nucleosome by around 1 kJ/mol (close to the average estimate of 2 kJ/mol obtained for from individual methylation studies), while each minor groove methylation destabilizes it by up to 5 kJ/mol (average free energy as single mutation is around 6 kJ/mol). This energetic position-dependence is the reverse of what was observed in a recent FRET/SAXS study [30]. The differences can be attributed to the use of different ionic conditions and different sequences: a modified Widom-601 sequence of 157 bp, which already contains multiple CpG steps in mixed orientations, and which could assume different positioning due to the introduction of new CpG steps and by effect of the methylation. The analysis of our trajectories reveals a larger root mean square deviation (RMSD) and fluctuation (RMSF; see Figures S2– S3 in Text S1) for the methylated nucleosomes, but failed to detect any systematic change in DNA geometry or in intermolecular DNA-histone energy related to methylation (Fig. S1B, S1C, S4–S6 in Text S1). The hydrophobic effect should favor orientation of the methyl group out from the solvent but this effect alone is not likely to justify the positional dependent stability changes in Figure 2, as the differential solvation of the methyl groups in the bound and unbound states is only in the order of a fraction of a water molecule (Figure S5 in Text S1). We find however, a reasonable correlation between methylation-induced changes in hydrogen bond and stacking interactions of the bases and the change in nucleosome stability (see Figure S6 in Text S1). This finding suggests that methylation-induced nucleosome destabilization is related to the poorer ability of methylated DNA to fit into the required conformation for DNA in a nucleosome. Changes in the elastic deformation energy between methylated and un-methylated DNA correlate with nucleosomal differential binding free energies To further analyze the idea that methylation-induced nucleosome destabilization is connected to a worse fit of methylated DNA into the required nucleosome-bound conformation, we computed the elastic energy of the nucleosomal DNA using a harmonic deformation method [36,37,44]. This method provides a rough estimate of the energy required to deform a DNA fiber to adopt the super helical conformation in the nucleosome (full details in Suppl. Information Text S1). As shown in Figure 2, there is an evident correlation between the increase that methylation produces in the elastic deformation energy (DDE def.) and the free energy variation (DDG bind.) computed from MD/TI calculations. Clearly, methylation increases the stiffness of the CpG step [31], raising the energy cost required to wrap DNA around the histone octamers. This extra energy cost will be smaller in regions of high positive roll (naked DNA MeCpG steps have a higher roll than CpG steps [31]) than in regions of high negative roll. Thus, simple elastic considerations explain why methylation is better tolerated when the DNA faces the histones through the major groove (where positive roll is required) that when it faces histones through the minor groove (where negative roll is required). Nucleosome methylation can give rise to nucleosome repositioning We have established that methylation affects the wrapping of DNA in nucleosomes, but how does this translate into chromatin structure? As noted above, accumulation of minor groove methylations strongly destabilizes the nucleosome, and could trigger nucleosome unfolding, or notable changes in positioning or phasing of DNA around the histone core. While accumulation of methylations might be well tolerated if placed in favorable positions, accumulation in unfavorable positions would destabilize the nucleosome, which might trigger changes in chromatin structure. Chromatin could in fact react in two different ways in response to significant levels of methylation in unfavorable positions: i) the DNA could either detach from the histone core, leading to nucleosome eviction or nucleosome repositioning, or ii) the DNA could rotate around the histone core, changing its phase to place MeCpG steps in favorable positions. Both effects are anticipated to alter DNA accessibility and impact gene expression regulation. The sub-microsecond time scale of our MD trajectories of methylated DNAs bound to nucleosomes is not large enough to capture these effects, but clear trends are visible in cases of multiple mutations occurring in unfavorable positions, where unmethylated and methylated DNA sequences are out of phase by around 28 degrees (Figure S7 in Text S1). Due to this repositioning, large or small, DNA could move and the nucleosome structure could assume a more compact and distorted conformation, as detected by Lee and Lee [29], or a slightly open conformation as found in Jimenez-Useche et al. [30]. Using the harmonic deformation method, we additionally predicted the change in stability induced by cytosine methylation for millions of different nucleosomal DNA sequences. Consistently with our calculations, we used two extreme scenarios to prepare our DNA sequences (see Fig. 3): i) all positions where the minor grooves contact the histone core are occupied by CpG steps, and ii) all positions where the major grooves contact the histone core are occupied by CpG steps. We then computed the elastic energy required to wrap the DNA around the histone proteins in unmethylated and methylated states, and, as expected, observed that methylation disfavors DNA wrapping (Figure 3A). We have rescaled the elastic energy differences with a factor of 0.23 to match the DDG prediction in figure 2B. In agreement with the rest of our results, our analysis confirms that the effect of methylation is position-dependent. In fact, the overall difference between the two extreme methylation scenarios (all-in-minor vs all-in-major) is larger than 60 kJ/mol, the average difference being around 15 kJ/ mol. We have also computed the elastic energy differences for a million sequences with CpG/MeCpG steps positioned at all possible intermediate locations with respect to the position (figure 3B). The large differences between the extreme cases can induce rotations of DNA around the histone core, shifting its phase to allow the placement of the methylated CpG steps facing the histones through the major groove. It is illustrative to compare the magnitude of CpG methylation penalty with sequence dependent differences. Since there are roughly 1.5e88 possible 147 base pairs long sequence combinations (i.e., (4n+4(n/2))/2, n = 147), it is unfeasible to calculate all the possible sequence effects. However, using our elastic model we can provide a range of values based on a reasonably large number of samples. If we consider all possible nucleosomal sequences in the yeast genome (around 12 Mbp), the energy difference between the best and the worst sequence that could form a nucleosome is 0.7 kj/mol per base (a minimum of 1 kJ/mol and maximum of around 1.7 kJ/mol per base, the first best and the last worst sequences are displayed in Table S3 in Text S1). We repeated the same calculation for one million random sequences and we obtained equivalent results. Placing one CpG step every helical turn gives an average energetic difference between minor groove and major groove methylation of 15 kJ/ mol, which translates into ,0.5 kJ/mol per methyl group, 2 kJ/ mol per base for the largest effects. Considering that not all nucleosome base pair steps are likely to be CpG steps, we can conclude that the balance between the destabilization due to CpG methylation and sequence repositioning will depend on the PLOS Computational Biology | www.ploscompbiol.org 4 November 2013 | Volume 9 | Issue 11 | e1003354 DNA Methylation and Nucleosome Positioning Figure 3. Methylated and non-methylated DNA elastic deformation energies. (A) Distribution of deformation energies for 147 bplong random DNA sequences with CpG steps positioned every 10 base steps (one helical turn) in minor (red and dark red) and major (light and dark blue) grooves respectively. The energy values were rescaled by the slope of a best-fit straight line of figure 2, which is 0.23, to por la lectura a través de la lectura de la prensa. La educación en los medios las fuerzas dispersas en función de los soportes mediáticos y orientarse más hacia la educación en medios que al dominio adquiere pleno derecho y entidad en la sección sexta titulada «competencias sociales y cívi- técnico de los aparatos. cas» que indica que «los alum- nos deberán ser capaces de juz- gar y tendrán espíritu crítico, lo que supone ser educados en los las programaciones oficiales, ya que, a lo largo de un medios y tener conciencia de su lugar y de su influencia estudio de los textos, los documentalistas del CLEMI en la sociedad». han podido señalar más de una centena de referencias a la educación de los medios en el seno de disciplinas 4. Un entorno positivo como el francés, la historia, la geografía, las lenguas, Si nos atenemos a las cifras, el panorama de la las artes plásticas : trabajos sobre las portadas de educación en medios es muy positivo. Una gran ope- prensa, reflexiones sobre temas mediáticos, análisis de ración de visibilidad como la «Semana de la prensa y publicidad, análisis de imágenes desde todos los ángu- de los medios en la escuela», coordinada por el CLE- los, reflexión sobre las noticias en los países europeos, MI, confirma año tras año, después de 17 convocato- información y opinión rias, el atractivo que ejerce sobre los profesores y los Esta presencia se constata desde la escuela mater- alumnos. Concebida como una gran operación de nal (2 a 6 años) donde, por ejemplo, se le pregunta a complementariedad entre la escuela y los profesiona- los niños más pequeños si saben diferenciar entre un les de los medios, alrededor del aprendizaje ciudada- periódico, un libro, un catálogo, a través de activida- no de la comunicación mediática, este evento moviliza des sensoriales, si saben para qué sirve un cartel, un durante toda una semana un porcentaje elevado de periódico, un cuaderno, un ordenador si son capa- centros escolares que representan un potencial de 4,3 ces de reconocer y distinguir imágenes de origen y de millones de alumnos (cifras de 2006). Basada en el naturaleza distintas. Podríamos continuar con más voluntariado, la semana permite desarrollar activida- ejemplos en todos los niveles de enseñanza y práctica- des más o menos ambiciosas centradas en la introduc- Páginas 43-48 ción de los medios en la vida de la escuela a través de la instalación de kioscos, organización de debates con profesionales y la confección por parte de los alumnos de documentos difundidos en los medios profesionales. Es la ocasión de dar un empujón a la educación en medios y de disfrutarlos. Los medios –un millar en 2006– se asocian de maneras diversas ofreciendo ejemplares de periódicos, acceso a noticias o a imágenes, proponiendo encuentros, permitiendo intervenir a los jóvenes en sus ondas o en sus columnas Esta operación da luz al trabajo de la educación en medios y moviliza a los diferentes participantes en el proyecto. 5. La formación de los docentes La formación es uno de los pilares principales de la educación en los medios. Su función es indispensable ya que no se trata de una disciplina, sino de una enseñanza que se hace sobre la base del voluntariado y del compromiso personal. Se trata de convencer, de mostrar, de interactuar. En primer lugar es necesario incluirla en la formación continua de los docentes, cuyo volumen se ha incrementado desde 1981 con la aparición de una verdadera política de formación continua de personal. Es difícil dar una imagen completa del volumen y del público, pero si nos atenemos a las cifras del CLEMI, hay más de 24.000 profesores que han asistido y se han involucrado durante 2004-05. 5.1. La formación continua En la mayoría de los casos, los profesores reciben su formación en contextos cercanos a su centro de trabajo, o incluso en este mismo. Después de una política centrada en la oferta que hacían los formadores, se valora más positivamente la demanda por parte del profesorado, ya que sólo así será verdaderamente fructífera. Los cursos de formación se repartieron en varias categorías: desde los formatos más tradicionales (cursos, debates, animaciones), hasta actividades de asesoramiento y de acompañamiento, y por supuesto los coloquios que permiten un trabajo en profundidad ya que van acompañados de expertos investigadores y profesionales. Citemos, por ejemplo en 2005, los coloquios del CLEMI-Toulouse sobre el cine documental o el del CLEMI-Dijon sobre «Políticos y medios: ¿connivencia?». Estos coloquios, que forman parte de un trabajo pedagógico regular, reagrupan a los diferentes participantes regionales y nacionales alrededor de grandes temas de la educación en medios y permiten generar nuevos conocimientos de aproximación y una profundización. Páginas 43-48 Hay otro tipo de formación original que se viene desarrollando desde hace menos tiempo, a través de cursos profesionales, como por ejemplo, en el Festival Internacional de Foto-periodismo «Visa para la imagen», en Perpignan. La formación se consolida en el curso, da acceso a las exposiciones, a las conferencias de profesionales y a los grandes debates, pero añade además propuestas pedagógicas y reflexiones didácticas destinadas a los docentes. Estas nuevas modalidades de formación son también consecuencia del agotamiento de la formación tradicional en las regiones. Los contenidos más frecuentes en formación continua conciernen tanto a los temas más clásicos como a los cambios que se están llevando a cabo en las prácticas mediáticas. Así encontramos distintas tendencias para 2004-05: La imagen desde el ángulo de la producción de imágenes animadas, el análisis de la imagen de la información o las imágenes del J.T. La prensa escrita y el periódico escolar. Internet y la información en línea. Medios y educación de los medios. 5.2 La formación inicial La formación inicial está aun en un grado muy ini- cial. El hecho de que la educación en medios no sea una disciplina impide su presencia en los IUFM (Institutos Universitarios de Formación de Maestros) que dan una prioridad absoluta a la didáctica de las disciplinas. En 2003, alrededor de 1.400 cursillistas sobre un total de 30.000 participaron en un momento u otro de un módulo de educación en medios. Estos módulos se ofrecen en función del interés que ese formador encuentra puntualmente y forman parte a menudo de varias disciplinas: documentación, letras, historia-geografía Estamos aún lejos de una política concertada en este dominio. La optativa «Cine-audiovisual» ha entrado desde hace muy poco tiempo en algunos IUFM destinada a obtener un certificado de enseñanza de la opción audiovisual y cine. Internet tiene cabida también en los cursos de formación inicial, recientemente con la aparición de un certificado informático y de Internet para los docentes, dirigido más a constatar competencias personales que a valorar una aptitud para enseñarlos. 6. ¿Y el futuro? El problema del futuro se plantea una vez más por la irrupción de nuevas técnicas y nuevos soportes. La difusión acelerada de lo digital replantea hoy muchas cuestiones relativas a prácticas mediáticas. Muchos Comunicar, 28, 2007 47 Comunicar, 28, 2007 Enrique Martínez-Salanova '2007 para Comunicar 48 trabajos que llevan el rótulo de la educación en medios solicitan una revisión ya que los conceptos cambian. La metodología elaborada en el marco de la educación en medios parece incluso permitir la inclinación de la sociedad de la información hacia una sociedad del conocimiento, como defiende la UNESCO. En Francia, se necesitaría unir las fuerzas dispersas en función de los soportes mediáticos y orientarse más hacia la educación en medios que al dominio técnico de los aparatos. Los avances recientes en el reconocimiento de estos contenidos y las competencias que supondrían podrían permitirlo. Referencias CLEMI/ACADEMIE DE BORDEAUX (Ed.) (2003): Parcours médias au collège: approches disciplinaires et transdisciplinaires. Aquitaine, Sceren-CRDP. GONNET, J. (2001): Education aux médias. Les controverses fécondes. Paris, Hachette Education/CNDP. SAVINO, J.; MARMIESSE, C. et BENSA, F. (2005): L’éducation aux médias de la maternelle au lycée. Direction de l’Enseignement Scolaire. Paris, Ministère de l’Education Nationale, Sceren/CNDP, Témoigner. BEVORT, E. et FREMONT, P. (2001): Médias, violence et education. Paris, CNDP, Actes et rapports pour l’éducation. – www.clemi.org: fiches pédagogiques, rapports et liens avec les pages régionales/académiques. – www.ac-nancy-metz.fr/cinemav/quai.html: Le site «Quai des images» est dédié à l’enseignement du cinéma et de l’audiovisuel. – www.france5.fr/education: la rubrique «Côté profs» a une entrée «education aux médias». – www.educaunet.org: Programme européen d’éducation aux risques liés à Internet. dResedfeleexliobnuetsacón Páginas 43-48
Proteomic Identification of Oxidized Proteins in Entamoeba histolytica by Resin-Assisted Capture: Insights into the Role of Arginase in Resistance to Oxidative Stress.
RECENT ACTIVITIES
Autor
Documento similar
Tags

Proteomic Identification of Oxidized Proteins in Entamoeba histolytica by Resin-Assisted Capture: Insights into the Role of Arginase in Resistance to Oxidative Stress.

Livre