Feedback

High beta-palmitate fat controls the intestinal inflammatory response and limits intestinal damage in mucin Muc2 deficient mice.

 0  4  9  2017-02-01 13:43:56 Report infringing document
Documento informativo
High Beta-Palmitate Fat Controls the Intestinal Inflammatory Response and Limits Intestinal Damage in Mucin Muc2 Deficient Mice Peng Lu1,2, Fabiana Bar-Yoseph3, Liora Levi3, Yael Lifshitz3, Janneke Witte-Bouma1, Adrianus C. J. M. de Bruijn1, Anita M. Korteland-van Male 1, Johannes B. van Goudoever 2,4 , Ingrid B. Renes1,2* 1 Division of Neonatology, Department of Pediatrics, Erasmus MC-Sophia, Rotterdam, the Netherlands, 2 Department of Pediatrics, Emma Children’s Hospital - AMC, Amsterdam, the Netherlands, 3 Enzymotec LTD, Kfar Baruch, Israel, 4 Department of Pediatrics, VU University Medical Center, Amsterdam, the Netherlands Abstract Background: Palmitic-acid esterified to the sn-1,3 positions of the glycerol backbone (alpha, alpha’-palmitate), the predominant palmitate conformation in regular infant formula fat, is poorly absorbed and might cause abdominal discomfort. In contrast, palmitic-acid esterified to the sn-2 position (beta-palmitate), the main palmitate conformation in human milk fat, is well absorbed. The aim of the present study was to examine the influence of high alpha, alpha’-palmitate fat (HAPF) diet and high beta-palmitate fat (HBPF) diet on colitis development in Muc2 deficient (Muc22/2) mice, a welldescribed animal model for spontaneous enterocolitis due to the lack of a protective mucus layer. Methods: Muc22/2 mice received AIN-93G reference diet, HAPF diet or HBPF diet for 5 weeks after weaning. Clinical symptoms, intestinal morphology and inflammation in the distal colon were analyzed. Results: Both HBPF diet and AIN-93G diet limited the extent of intestinal erosions and morphological damage in Muc22/2 mice compared with HAPF diet. In addition, the immunosuppressive regulatory T (Treg) cell response as demonstrated by the up-regulation of Foxp3, Tgfb1 and Ebi3 gene expression levels was enhanced by HBPF diet compared with AIN-93G and HAPF diets. HBPF diet also increased the gene expression of Pparg and enzymatic antioxidants (Sod1, Sod3 and Gpx1), genes all reported to be involved in promoting an immunosuppressive Treg cell response and to protect against colitis. Conclusions: This study shows for the first time that HBPF diet limits the intestinal mucosal damage and controls the inflammatory response in Muc22/2 mice by inducing an immunosuppressive Treg cell response. Citation: Lu P, Bar-Yoseph F, Levi L, Lifshitz Y, Witte-Bouma J, et al. (2013) High Beta-Palmitate Fat Controls the Intestinal Inflammatory Response and Limits Intestinal Damage in Mucin Muc2 Deficient Mice. PLoS ONE 8(6): e65878. doi:10.1371/journal.pone.0065878 Editor: Jean-Luc Desseyn, Inserm, France Received January 18, 2013; Accepted April 29, 2013; Published June 12, 2013 Copyright: ß 2013 Lu et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Funding: The study was funded by Enzymotec LTD. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Competing Interests: The study was funded by Enzymotec LTD. FBY, LL, and YL are employees of Enzymotec LTD. All other authors have stated that they have no conflict of interest. This does not alter the authors’ adherence to all the PLOS ONE policies on sharing data and materials. * E-mail: i.b.renes@amc.uva.nl enhance the proliferation of spleen lymphocytes [11]. However, the influence of HBPF on intestinal damage remains unknown. Mucins are the principal components of the intestinal mucus layer [12], which forms a physical barrier protecting the underlying epithelium against luminal substances and microbes [13,14,15]. Deficiency of Muc2 affects the protective capacities of the mucus layer [16], and as a consequence, bacteria are in direct contact with the intestinal epithelial cells [17]. This in its turn leads to the development of spontaneous colitis in Muc22/2 mice, a well-described animal model for enterocolitis [18,19,20]. In this model, colonic mucosal damage is not observed before weaning when immunosuppressive regulatory T (Treg) cells dominate the immune response. Interestingly, after weaning the Treg cell response declines and mucosal damage appears [21]. These data suggest that components of human milk might be able to limit intestinal inflammation and beta-palmitate could be such a component. Furthermore, increasing evidence has shown a Introduction Human milk provides the best nourishment for full-term infants, by which approximately half of the dietary calories are supplied as fat [1]. More than 98% of milk fat is in the form of triglycerides containing fatty acids esterified to glycerol, with palmitic acid (C16:0) representing about 20–25% of total milk fatty acid. In human milk, palmitic acid is predominantly esterified to the sn-2 position of the triglyceride (beta-palmitate) [2]. However, in vegetable oils, the main constituents of infant formula fat, the palmitic acid is predominantly esterified to the sn-1,3 positions of the triglycerides (alpha, alpha’-palmitate) [3]. Structured triglycerides (synthetic beta-palmitate) are synthesized through enzymatic processing, whereby a large amount of alpha, alpha’-palmitate fat is converted to beta-palmitate fat [4,5]. It has been reported that high beta-palmitate fat (HBPF) rather than high alpha, alpha’palmitate fat (HAPF) enables easy digestion and absorption of fatty acid [6,7,8,9] and calcium [10]. Moreover, HBPF was shown to PLOS ONE | www.plosone.org 1 June 2013 | Volume 8 | Issue 6 | e65878 HBPF Limits Intestinal Inflammation protective role of Treg cells in inflammatory diseases [22], and patients with inflammatory bowel diseases (IBD) have reduced Treg cell numbers compared with patients with non-IBD inflammatory diseases [23]. The present study was designed to investigate the influence of alpha, alpha’-palmitate fat and beta-palmitate fat on colitis development in Muc22/2 mice. We hypothesized that HBPF diet, which mimics the fat composition and properties of human milk fat, limits the intestinal mucosal damage and controls the inflammatory response in Muc22/2 mice. Therefore, Muc22/2 mice were fed AIN-93G reference diet [24], HAPF diet or HBPF diet for 5 weeks after weaning, and clinical symptoms and intestinal damage and inflammation were analyzed. Table 1. Fatty acid composition in the diets. AIN-93G HAPF HBPF C8 nd nd nd C10 nd nd nd C12 nd nd 0.2 C14 nd 0.3 0.2 C15 nd nd nd Fatty acid composition (%) Methods Animals The 129Sv-Muc22/2 mice were generated from Muc2 heterozygous mice as previously described [19]. All mice were housed in the same specific pathogen-free environment with free access to acidified tap water in a 12-hour light/dark cycle. All animal experiments were reviewed by and performed with approval of the Erasmus MC Animal Ethics Committee (approval number: EMC 2087), Rotterdam, the Netherlands. All mice were tested negative for Helicobacter hepaticus and norovirus infection. C16 11.1 16.7 16.8 C16:1 0.1 0.2 0.1 C17 nd nd nd C18 4.5 3.4 3.8 C18:1 24.7 36 42.2 C18:2 (n-6) 51.6 40.3 34 C18:3 (n-3) 6.6 1.8 1.5 C20 0.4 0.3 0.3 C20:1 0.2 0.3 0.3 C22 0.4 0.4 0.4 C22:1 0.3 0.1 0.1 C24 0.1 0.2 0.1 Experimental Setup C16 sn-2 2.1 5.5 25.4 Muc22/2 mice were divided into three diet groups which only differed in fat compositions: standard AIN-93G diet as a reference group, HAPF diet and HBPF (InFatTM, Advanced Lipids AB) diet containing 11.1%, 16.7% and 16.8% total palmitic acid, with 6.3%, 11.0% and 50.4% of the palmitic acid esterified to the sn-2 position, respectively (see Table 1 for more detailed information on fatty acid composition). Three male and 3 female mice were included in each group. All three diets were prepared by Research Diet Services, Wijk bij Duurstede, the Netherlands. Animals were weaned from mother’s milk at the age of 23 or 24 days, housed separately, and received one of the above described diets Ad libitum for 5 weeks. The food intake and body weight were recorded each week. Animals were sacrificed at the end of experiment, and colonic tissue samples were excised immediately and either fixed in 4% (w/v) paraformaldehyde in phosphate-buffered saline or stored in RNAlater (Qiagen, Venlo, the Netherlands) at 220uC. C16 sn-2/total C16 (%) 6.3 11.0 50.4 Total fat content/diet (%) 7.2 7.2 7.1 nd: not detected. doi:10.1371/journal.pone.0065878.t001 the sections for 20 min in 0.01 M sodium citrate (pH 6.0) at 100uC. CD3e-positive and S100a8-positive cells were detected using antibodies against CD3e (Dako, Glostrup, Denmark) and S100a8 (R&D Systems, Abingdon, United Kingdom), respectively. RNA Isolation and Quantitative PCR (qPCR) Total RNA was isolated using the QIAamp RNA midi-kit (Qiagen, Venlo, the Netherlands) following the manufacturer’s protocol. Complementary DNA was synthesized from 1.5 mg RNA using M-MLV reverse transcriptase (Promega, Leiden, the Netherlands). The qPCR analysis was performed based on the intercalation of SYBR Green on an ABI Prism 7700 sequence detection system (PE Applied Biosystems, Foster City, United States) as previously described [19]. The relative mRNA expression levels were normalized against b-Actin (Actb) expression levels of each mouse. The sequences of all primers used for qPCR are given in Table 2. The oligonucleotide sequences were designed using OLIGO 6.22 software based on the gene sequences and purchased from Invitrogen. All primers had a melting temperature between 65uC and 66.5uC. The specificity and efficiency of all primer sets were tested, and all PCRs performed with comparable efficiencies of 95% or higher. Histology and Immunohistochemistry Paraformaldehyde fixed colonic tissues were embedded in paraffin, and 4-mm-thick sections were stained with hematoxylin and eosin to study histologic changes as described previously [25]. The erosion score was assessed as follows: 0, no erosions; 1, 0–25% of the epithelium is erosive; 2, 25–50% of the epithelium is erosive; 3, 50–75% of the epithelium is erosive; 4, 75–100% of the epithelium is erosive; 5, 100% erosions (i.e. no epithelium present). To detect differences in mucosal and epithelial thickness in the colon, 5 to 10 well-oriented crypts were chosen per intestinal segment and measured using calibrated Leica Image Manager 500 software (Leica Microsystems, Rijswijk, the Netherlands). All data were obtained in a blinded fashion by 2 independent investigators. Immunohistochemistry was performed using the Vectastain Elite ABC kit (Vector Laboratories, Burlingame, United States) and 3,39-diaminobenzidine as staining reagent as previously described [19,20]. Antigen unmasking was carried out by heating PLOS ONE | www.plosone.org Statistical Analysis The data are expressed as median or mean 6 SEM. The data from HBPF and HAPF groups were compared using Chisquare test or Mann-Whitney test. AIN-93G group served as a reference group; therefore all parameters were also compared with this group. The data were considered statistically significant at p,0.05. 2 June 2013 | Volume 8 | Issue 6 | e65878 HBPF Limits Intestinal Inflammation HAPF, but not HBPF, Increases Intestinal Mucosal Damage Table 2. Primer sequences used for qPCR in this study. Target gene Forward Primer (59–39) Reverse Primer (59– 39) Actb GGGACCTGACGGACTAC TGCCACAGGATTCCATAC Cd45 TTTGGGAACATTACTGTGAA TGGAGCACATGAGTCATTAG Cd3e CCAGCCTCAAATAAAAACA TTGGCCTTCCTATTCTTG Tnf TGGCCTCCCTCTCATC GGCTGGCACCACTAGTT Foxp3 ACACCCAGGAAAGACAG GGCAGTGCTTGAGAAAC Tgfb1 AACCAAAGACATCTCACACA GCCAGGAATTGTTGCTAT Ebi3 CCCGGACATCTTCTCTCT GAGGCTCCAGTCACTTG Il12a GCCTTGGTAGCATCTATGAG TCGGCATTATGATTCAGAGA Pparg CAGTTTCGATCCGTAGAAGC CCATAAAGTCACCAAAGGGC Sod1 GATCGTGTGATCTCACTCTC TTGTTTCTCATGGACCAC Sod3 GAACTTCACCAGAGGGAA GACATGGTGACAGAGCC Gpx1 CCCGTGCAATCAGTTC TTCGCACTTCTCAAACAA Ruffled, flattened and erosive epithelia were observed in the distal colon of all Muc22/2 mice. However, the extent of morphological changes within the surface epithelium varied among the groups (Figure 2A). The remaining surface epithelium in the AIN-93G group consisted of approximately 20–30% normal, polarized, columnar epithelial cells, and 30–70% of the epithelial cells were ruffled and flattened. However, the remaining surface epithelium of the animals in the HAPF group showed extensive damage, and normal epithelial cells were not observed in these animals. The HBPF group exhibited similar results to those observed in the AIN-93G reference group. In line with this, the erosion score was significantly increased in the HAPF group compared with HBPF and AIN-93G groups (Figure 2B). We previously identified crypt lengthening as a site-specific marker for colitis severity in Muc22/2 mice [19,20]. Therefore we analyzed crypt lengths in Muc22/2 mice fed the different diets. No significant differences were observed among the three diet groups (Figure 2C). doi:10.1371/journal.pone.0065878.t002 HAPF and HBPF do not Alter the Mucosal T cell Influx in the Distal Colon Results Following the relatively normal surface epithelial morphology in HBPF group compared with HAPF group, we next determined whether HBPF suppressed the inflammatory response in Muc22/2 mice. We used the influx of CD3e-positive T cells as a marker for intestinal inflammation. In the distal colon, the amount of CD3e-positive T cells did not differ among the three diet groups (Figure 3A). We also performed immunohistochemistry for S100a8, an inflammation related protein which is mainly produced by neutrophils. Similarly, the abundance of S100a8-positive cells did not differ among the three diet groups (Figure 3B). In addition to the immunohistochemical analysis, the mRNA expression levels of Cd45 and Cd3e were also quantified. No differences were seen in the mRNA expression levels of Cd45 and Cd3e among the three diet groups (Figure 3C & 3D), indicating that the total numbers of hematopoietic cells and T cells were not altered by the type of diet studied. Clinical Symptoms The fats did not affect total food intake as no significant differences among the HAPF, HBPF and AIN-93G groups was observed during the study period (Figure 1A). Weight loss or growth retardation is considered as one of the major clinical symptoms of colitis, and therefore, we next compared body weights. The mean value of body weight of mice fed HAPF diet was slightly lower than that of mice fed AIN-93G or HBPF diets, but the differences were not statistically significant at any time point investigated (Figure 1B). Another clinical symptom of colitis is rectal bleeding. At the age of 8 weeks, 2 of 6 mice (33%) from the AIN-93G diet group, 3 of 6 mice (50%) from the HAPF diet group and only 1 of 6 mice (16%) from the HBPF diet group showed rectal bleeding. Figure 1. Clinical Symptoms of Muc22/2 mice fed AIN-93G, HAPF or HBPF diet. Food intake (A) and body weights (B) of mice fed AIN-93G, HAPF or HBPF diet were recorded from the age of 4 weeks until the end of the study. Each group represents 6 animals in total; 3 males and 3 females. doi:10.1371/journal.pone.0065878.g001 PLOS ONE | www.plosone.org 3 June 2013 | Volume 8 | Issue 6 | e65878 HBPF Limits Intestinal Inflammation Figure 2. Morphology of the distal colon of Muc22/2 mice fed AIN-93G, HAPF or HBPF diet. Distal colonic sections of mice fed with different diets were stained with haematoxylin and eosin, and representative sections of each diet group are shown (A). Panels with an asterisk represent a higher magnification of the surface epithelium of the distal colon. Erosion scores (B) and crypt lengths (C) within in each diet group are shown. Images are representative for all the mice in each diet group. doi:10.1371/journal.pone.0065878.g002 regulated in HBPF group compared with HAPF and AIN-93G groups (Figure 4A), suggesting that HBPF induced an immunosuppressive Treg cell response. Treg cells suppress the pro-inflammatory response by inhibiting effector T cells primarily through the production of cytokines, such as transforming growth factor beta 1 (Tgfb1) and interleukin 35 (IL35) [26,27]. HBPF diet significantly up-regulated Tgfb1 mRNA expression levels in the distal colon compared with HAPF diet (Figure 4B). IL35 is a heterodimeric cytokine composed of an interleukin 12A (IL12a) subunit and an Epstein-Barr virus induced 3 (Ebi3) subunit. Interestingly, Ebi3 mRNA expression levels were up-regulated in the HBPF group compared with the HAPF group and the AIN-93G (Figure 4C), and Il12a mRNA levels trended higher in the HBPF group (Figure 4D). There were no differences We next quantified the expression of the pro-inflammatory cytokine tumor necrosis factor-a (Tnf). There was no significant difference in Tnf expression levels between mice fed HBPF and HAPF diets (Figure 3E), and there were also no significant differences in the mRNA expression levels of other inflammatory markers such as inducible nitric oxide synthase 2 (iNos2), interleukin 1 beta (Il1b), interleukin 4 (Il4), and the Th17 signature cytokines interleukin 17 (Il17) and interleukin 22 (Il22) (data not shown). HBPF Enhances Regulatory T cell Response Treg cells are shown to have immunosuppressive capacities [22], and therefore, we next determined the Treg response in the three diet groups. The Foxp3 mRNA expression did not differ between HAPF and AIN-93G groups, but it was significantly up- PLOS ONE | www.plosone.org 4 June 2013 | Volume 8 | Issue 6 | e65878 HBPF Limits Intestinal Inflammation PLOS ONE | www.plosone.org 5 June 2013 | Volume 8 | Issue 6 | e65878 HBPF Limits Intestinal Inflammation Figure 3. Inflammatory response in the distal colon of Muc22/2 mice fed AIN-93G, HAPF or HBPF diet. Representative stainings of CD3epositive T cells (A) and equilibrium value of MeCpG steps (,+14 deg.) [31,44]. In comparison, methylation has a significantly lower stability cost when happening at major groove positions, such as 211 and 21 base pair from dyad (mutations 9 and 12), where the roll of the nucleosome bound conformation (+10 deg.) is more compatible with the equilibrium geometry of MeCpG steps. The nucleosome destabilizing effect of cytosine methylation increases with the number of methylated cytosines, following the same position dependence as the single methylations. The multiple-methylation case reveals that each major groove meth- PLOS Computational Biology | www.ploscompbiol.org 3 November 2013 | Volume 9 | Issue 11 | e1003354 DNA Methylation and Nucleosome Positioning ylation destabilizes the nucleosome by around 1 kJ/mol (close to the average estimate of 2 kJ/mol obtained for from individual methylation studies), while each minor groove methylation destabilizes it by up to 5 kJ/mol (average free energy as single mutation is around 6 kJ/mol). This energetic position-dependence is the reverse of what was observed in a recent FRET/SAXS study [30]. The differences can be attributed to the use of different ionic conditions and different sequences: a modified Widom-601 sequence of 157 bp, which already contains multiple CpG steps in mixed orientations, and which could assume different positioning due to the introduction of new CpG steps and by effect of the methylation. The analysis of our trajectories reveals a larger root mean square deviation (RMSD) and fluctuation (RMSF; see Figures S2– S3 in Text S1) for the methylated nucleosomes, but failed to detect any systematic change in DNA geometry or in intermolecular DNA-histone energy related to methylation (Fig. S1B, S1C, S4–S6 in Text S1). The hydrophobic effect should favor orientation of the methyl group out from the solvent but this effect alone is not likely to justify the positional dependent stability changes in Figure 2, as the differential solvation of the methyl groups in the bound and unbound states is only in the order of a fraction of a water molecule (Figure S5 in Text S1). We find however, a reasonable correlation between methylation-induced changes in hydrogen bond and stacking interactions of the bases and the change in nucleosome stability (see Figure S6 in Text S1). This finding suggests that methylation-induced nucleosome destabilization is related to the poorer ability of methylated DNA to fit into the required conformation for DNA in a nucleosome. Changes in the elastic deformation energy between methylated and un-methylated DNA correlate with nucleosomal differential binding free energies To further analyze the idea that methylation-induced nucleosome destabilization is connected to a worse fit of methylated DNA into the required nucleosome-bound conformation, we computed the elastic energy of the nucleosomal DNA using a harmonic deformation method [36,37,44]. This method provides a rough estimate of the energy required to deform a DNA fiber to adopt the super helical conformation in the nucleosome (full details in Suppl. Information Text S1). As shown in Figure 2, there is an evident correlation between the increase that methylation produces in the elastic deformation energy (DDE def.) and the free energy variation (DDG bind.) computed from MD/TI calculations. Clearly, methylation increases the stiffness of the CpG step [31], raising the energy cost required to wrap DNA around the histone octamers. This extra energy cost will be smaller in regions of high positive roll (naked DNA MeCpG steps have a higher roll than CpG steps [31]) than in regions of high negative roll. Thus, simple elastic considerations explain why methylation is better tolerated when the DNA faces the histones through the major groove (where positive roll is required) that when it faces histones through the minor groove (where negative roll is required). Nucleosome methylation can give rise to nucleosome repositioning We have established that methylation affects the wrapping of DNA in nucleosomes, but how does this translate into chromatin structure? As noted above, accumulation of minor groove methylations strongly destabilizes the nucleosome, and could trigger nucleosome unfolding, or notable changes in positioning or phasing of DNA around the histone core. While accumulation of methylations might be well tolerated if placed in favorable positions, accumulation in unfavorable positions would destabilize the nucleosome, which might trigger changes in chromatin structure. Chromatin could in fact react in two different ways in response to significant levels of methylation in unfavorable positions: i) the DNA could either detach from the histone core, leading to nucleosome eviction or nucleosome repositioning, or ii) the DNA could rotate around the histone core, changing its phase to place MeCpG steps in favorable positions. Both effects are anticipated to alter DNA accessibility and impact gene expression regulation. The sub-microsecond time scale of our MD trajectories of methylated DNAs bound to nucleosomes is not large enough to capture these effects, but clear trends are visible in cases of multiple mutations occurring in unfavorable positions, where unmethylated and methylated DNA sequences are out of phase by around 28 degrees (Figure S7 in Text S1). Due to this repositioning, large or small, DNA could move and the nucleosome structure could assume a more compact and distorted conformation, as detected by Lee and Lee [29], or a slightly open conformation as found in Jimenez-Useche et al. [30]. Using the harmonic deformation method, we additionally predicted the change in stability induced by cytosine methylation for millions of different nucleosomal DNA sequences. Consistently with our calculations, we used two extreme scenarios to prepare our DNA sequences (see Fig. 3): i) all positions where the minor grooves contact the histone core are occupied by CpG steps, and ii) all positions where the major grooves contact the histone core are occupied by CpG steps. We then computed the elastic energy required to wrap the DNA around the histone proteins in unmethylated and methylated states, and, as expected, observed that methylation disfavors DNA wrapping (Figure 3A). We have rescaled the elastic energy differences with a factor of 0.23 to match the DDG prediction in figure 2B. In agreement with the rest of our results, our analysis confirms that the effect of methylation is position-dependent. In fact, the overall difference between the two extreme methylation scenarios (all-in-minor vs all-in-major) is larger than 60 kJ/mol, the average difference being around 15 kJ/ mol. We have also computed the elastic energy differences for a million sequences with CpG/MeCpG steps positioned at all possible intermediate locations with respect to the position (figure 3B). The large differences between the extreme cases can induce rotations of DNA around the histone core, shifting its phase to allow the placement of the methylated CpG steps facing the histones through the major groove. It is illustrative to compare the magnitude of CpG methylation penalty with sequence dependent differences. Since there are roughly 1.5e88 possible 147 base pairs long sequence combinations (i.e., (4n+4(n/2))/2, n = 147), it is unfeasible to calculate all the possible sequence effects. However, using our elastic model we can provide a range of values based on a reasonably large number of samples. If we consider all possible nucleosomal sequences in the yeast genome (around 12 Mbp), the energy difference between the best and the worst sequence that could form a nucleosome is 0.7 kj/mol per base (a minimum of 1 kJ/mol and maximum of around 1.7 kJ/mol per base, the first best and the last worst sequences are displayed in Table S3 in Text S1). We repeated the same calculation for one million random sequences and we obtained equivalent results. Placing one CpG step every helical turn gives an average energetic difference between minor groove and major groove methylation of 15 kJ/ mol, which translates into ,0.5 kJ/mol per methyl group, 2 kJ/ mol per base for the largest effects. Considering that not all nucleosome base pair steps are likely to be CpG steps, we can conclude that the balance between the destabilization due to CpG methylation and sequence repositioning will depend on the PLOS Computational Biology | www.ploscompbiol.org 4 November 2013 | Volume 9 | Issue 11 | e1003354 DNA Methylation and Nucleosome Positioning Figure 3. Methylated and non-methylated DNA elastic deformation energies. (A) Distribution of deformation energies for 147 bplong random DNA sequences with CpG steps positioned every 10 base steps (one helical turn) in minor (red and dark red) and major (light and dark blue) grooves respectively. The energy values were rescaled by the slope of a best-fit straight line of figure 2, which is 0.23, to por la lectura a través de la lectura de la prensa. La educación en los medios las fuerzas dispersas en función de los soportes mediáticos y orientarse más hacia la educación en medios que al dominio adquiere pleno derecho y entidad en la sección sexta titulada «competencias sociales y cívi- técnico de los aparatos. cas» que indica que «los alum- nos deberán ser capaces de juz- gar y tendrán espíritu crítico, lo que supone ser educados en los las programaciones oficiales, ya que, a lo largo de un medios y tener conciencia de su lugar y de su influencia estudio de los textos, los documentalistas del CLEMI en la sociedad». han podido señalar más de una centena de referencias a la educación de los medios en el seno de disciplinas 4. Un entorno positivo como el francés, la historia, la geografía, las lenguas, Si nos atenemos a las cifras, el panorama de la las artes plásticas : trabajos sobre las portadas de educación en medios es muy positivo. Una gran ope- prensa, reflexiones sobre temas mediáticos, análisis de ración de visibilidad como la «Semana de la prensa y publicidad, análisis de imágenes desde todos los ángu- de los medios en la escuela», coordinada por el CLE- los, reflexión sobre las noticias en los países europeos, MI, confirma año tras año, después de 17 convocato- información y opinión rias, el atractivo que ejerce sobre los profesores y los Esta presencia se constata desde la escuela mater- alumnos. Concebida como una gran operación de nal (2 a 6 años) donde, por ejemplo, se le pregunta a complementariedad entre la escuela y los profesiona- los niños más pequeños si saben diferenciar entre un les de los medios, alrededor del aprendizaje ciudada- periódico, un libro, un catálogo, a través de activida- no de la comunicación mediática, este evento moviliza des sensoriales, si saben para qué sirve un cartel, un durante toda una semana un porcentaje elevado de periódico, un cuaderno, un ordenador si son capa- centros escolares que representan un potencial de 4,3 ces de reconocer y distinguir imágenes de origen y de millones de alumnos (cifras de 2006). Basada en el naturaleza distintas. Podríamos continuar con más voluntariado, la semana permite desarrollar activida- ejemplos en todos los niveles de enseñanza y práctica- des más o menos ambiciosas centradas en la introduc- Páginas 43-48 ción de los medios en la vida de la escuela a través de la instalación de kioscos, organización de debates con profesionales y la confección por parte de los alumnos de documentos difundidos en los medios profesionales. Es la ocasión de dar un empujón a la educación en medios y de disfrutarlos. Los medios –un millar en 2006– se asocian de maneras diversas ofreciendo ejemplares de periódicos, acceso a noticias o a imágenes, proponiendo encuentros, permitiendo intervenir a los jóvenes en sus ondas o en sus columnas Esta operación da luz al trabajo de la educación en medios y moviliza a los diferentes participantes en el proyecto. 5. La formación de los docentes La formación es uno de los pilares principales de la educación en los medios. Su función es indispensable ya que no se trata de una disciplina, sino de una enseñanza que se hace sobre la base del voluntariado y del compromiso personal. Se trata de convencer, de mostrar, de interactuar. En primer lugar es necesario incluirla en la formación continua de los docentes, cuyo volumen se ha incrementado desde 1981 con la aparición de una verdadera política de formación continua de personal. Es difícil dar una imagen completa del volumen y del público, pero si nos atenemos a las cifras del CLEMI, hay más de 24.000 profesores que han asistido y se han involucrado durante 2004-05. 5.1. La formación continua En la mayoría de los casos, los profesores reciben su formación en contextos cercanos a su centro de trabajo, o incluso en este mismo. Después de una política centrada en la oferta que hacían los formadores, se valora más positivamente la demanda por parte del profesorado, ya que sólo así será verdaderamente fructífera. Los cursos de formación se repartieron en varias categorías: desde los formatos más tradicionales (cursos, debates, animaciones), hasta actividades de asesoramiento y de acompañamiento, y por supuesto los coloquios que permiten un trabajo en profundidad ya que van acompañados de expertos investigadores y profesionales. Citemos, por ejemplo en 2005, los coloquios del CLEMI-Toulouse sobre el cine documental o el del CLEMI-Dijon sobre «Políticos y medios: ¿connivencia?». Estos coloquios, que forman parte de un trabajo pedagógico regular, reagrupan a los diferentes participantes regionales y nacionales alrededor de grandes temas de la educación en medios y permiten generar nuevos conocimientos de aproximación y una profundización. Páginas 43-48 Hay otro tipo de formación original que se viene desarrollando desde hace menos tiempo, a través de cursos profesionales, como por ejemplo, en el Festival Internacional de Foto-periodismo «Visa para la imagen», en Perpignan. La formación se consolida en el curso, da acceso a las exposiciones, a las conferencias de profesionales y a los grandes debates, pero añade además propuestas pedagógicas y reflexiones didácticas destinadas a los docentes. Estas nuevas modalidades de formación son también consecuencia del agotamiento de la formación tradicional en las regiones. Los contenidos más frecuentes en formación continua conciernen tanto a los temas más clásicos como a los cambios que se están llevando a cabo en las prácticas mediáticas. Así encontramos distintas tendencias para 2004-05: La imagen desde el ángulo de la producción de imágenes animadas, el análisis de la imagen de la información o las imágenes del J.T. La prensa escrita y el periódico escolar. Internet y la información en línea. Medios y educación de los medios. 5.2 La formación inicial La formación inicial está aun en un grado muy ini- cial. El hecho de que la educación en medios no sea una disciplina impide su presencia en los IUFM (Institutos Universitarios de Formación de Maestros) que dan una prioridad absoluta a la didáctica de las disciplinas. En 2003, alrededor de 1.400 cursillistas sobre un total de 30.000 participaron en un momento u otro de un módulo de educación en medios. Estos módulos se ofrecen en función del interés que ese formador encuentra puntualmente y forman parte a menudo de varias disciplinas: documentación, letras, historia-geografía Estamos aún lejos de una política concertada en este dominio. La optativa «Cine-audiovisual» ha entrado desde hace muy poco tiempo en algunos IUFM destinada a obtener un certificado de enseñanza de la opción audiovisual y cine. Internet tiene cabida también en los cursos de formación inicial, recientemente con la aparición de un certificado informático y de Internet para los docentes, dirigido más a constatar competencias personales que a valorar una aptitud para enseñarlos. 6. ¿Y el futuro? El problema del futuro se plantea una vez más por la irrupción de nuevas técnicas y nuevos soportes. La difusión acelerada de lo digital replantea hoy muchas cuestiones relativas a prácticas mediáticas. Muchos Comunicar, 28, 2007 47 Comunicar, 28, 2007 Enrique Martínez-Salanova '2007 para Comunicar 48 trabajos que llevan el rótulo de la educación en medios solicitan una revisión ya que los conceptos cambian. La metodología elaborada en el marco de la educación en medios parece incluso permitir la inclinación de la sociedad de la información hacia una sociedad del conocimiento, como defiende la UNESCO. En Francia, se necesitaría unir las fuerzas dispersas en función de los soportes mediáticos y orientarse más hacia la educación en medios que al dominio técnico de los aparatos. Los avances recientes en el reconocimiento de estos contenidos y las competencias que supondrían podrían permitirlo. Referencias CLEMI/ACADEMIE DE BORDEAUX (Ed.) (2003): Parcours médias au collège: approches disciplinaires et transdisciplinaires. Aquitaine, Sceren-CRDP. GONNET, J. (2001): Education aux médias. Les controverses fécondes. Paris, Hachette Education/CNDP. SAVINO, J.; MARMIESSE, C. et BENSA, F. (2005): L’éducation aux médias de la maternelle au lycée. Direction de l’Enseignement Scolaire. Paris, Ministère de l’Education Nationale, Sceren/CNDP, Témoigner. BEVORT, E. et FREMONT, P. (2001): Médias, violence et education. Paris, CNDP, Actes et rapports pour l’éducation. – www.clemi.org: fiches pédagogiques, rapports et liens avec les pages régionales/académiques. – www.ac-nancy-metz.fr/cinemav/quai.html: Le site «Quai des images» est dédié à l’enseignement du cinéma et de l’audiovisuel. – www.france5.fr/education: la rubrique «Côté profs» a une entrée «education aux médias». – www.educaunet.org: Programme européen d’éducation aux risques liés à Internet. dResedfeleexliobnuetsacón Páginas 43-48
High beta-palmitate fat controls the intestinal inflammatory response and limits intestinal damage in mucin Muc2 deficient mice.
RECENT ACTIVITIES
Autor
Documento similar
Tags

High beta-palmitate fat controls the intestinal inflammatory response and limits intestinal damage in mucin Muc2 deficient mice.

Livre