Feedback

Met receptor tyrosine kinase signaling induces secretion of the angiogenic chemokine interleukin-8/CXCL8 in pancreatic cancer.

Documento informativo
Met Receptor Tyrosine Kinase Signaling Induces Secretion of the Angiogenic Chemokine Interleukin-8/ CXCL8 in Pancreatic Cancer Kristen S. Hill1, Ivana Gaziova1, Lindsay Harrigal1, Yvette A. Guerra1, Suimin Qiu2,4, Sarita K. Sastry3,4, Thiruvengadam Arumugam5, Craig D. Logsdon5, Lisa A. Elferink1,4* 1 Department of Neuroscience and Cell Biology, University of Texas Medical Branch, Galveston, Texas, United States of America, 2 Department of Pathology, University of Texas Medical Branch, Galveston, Texas, United States of America, 3 Department of Biochemistry and Molecular Biology, University of Texas Medical Branch, Galveston, Texas, United States of America, 4 UTMB Cancer Center, University of Texas Medical Branch, Galveston, Texas, United States of America, 5 Department of Cancer Biology, University of Texas M. D. Anderson Cancer Center, Houston, Texas, United States of America Abstract At diagnosis, the majority of pancreatic cancer patients present with advanced disease when curative resection is no longer feasible and current therapeutic treatments are largely ineffective. An improved understanding of molecular targets for effective intervention of pancreatic cancer is thus urgent. The Met receptor tyrosine kinase is one candidate implicated in pancreatic cancer. Notably, Met is over expressed in up to 80% of invasive pancreatic cancers but not in normal ductal cells correlating with poor overall patient survival and increased recurrence rates following surgical resection. However the functional role of Met signaling in pancreatic cancer remains poorly understood. Here we used RNA interference to directly examine the pathobiological importance of increased Met signaling for pancreatic cancer. We show that Met knockdown in pancreatic tumor cells results in decreased cell survival, cell invasion, and migration on collagen I in vitro. Using an orthotopic model for pancreatic cancer, we provide in vivo evidence that Met knockdown reduced tumor burden correlating with decreased cell survival and tumor angiogenesis, with minimal effect on cell growth. Notably, we report that Met signaling regulates the secretion of the pro-angiogenic chemokine interleukin-8/CXCL8. Our data showing that the interleukin-8 receptors CXCR1 and CXCR2 are not expressed on pancreatic tumor cells, suggests a paracrine mechanism by which Met signaling regulates interleukin-8 secretion to remodel the tumor microenvironment, a novel finding that could have important clinical implications for improving the effectiveness of treatments for pancreatic cancer. Citation: Hill KS, Gaziova I, Harrigal L, Guerra YA, Qiu S, et al. (2012) Met Receptor Tyrosine Kinase Signaling Induces Secretion of the Angiogenic Chemokine Interleukin-8/CXCL8 in Pancreatic Cancer. PLoS ONE 7(7): e40420. doi:10.1371/journal.pone.0040420 Editor: Surinder K. Batra, University of Nebraska Medical Center, United States of America Received February 15, 2012; Accepted June 6, 2012; Published July 17, 2012 Copyright: ß 2012 Hill et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Funding: This work was supported by grants from the National Institutes of Health CA-119075 to L.A.E., DK-052067 to C.D.L., and CA-118405 to S.K.S. K.S.H. was supported by training grant NIH/NCI Multidisciplinary Training in Cancer Research, T32 (CA117834-03). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Competing Interests: The authors have declared that no competing interests exist. * E-mail: lisa.elferink@utmb.edu of function mutations in tumor suppressor p53 and p16INK4a) [10] and PanIN-3 (inactivation of p53, SMAD4/DPC4 and BRCA2) [8,11,12]. In contrast to these early stage preinvasive lesions, PDAC has a lack of defined mechanisms. Several signaling pathways are likely involved in PDAC. One candidate is the Met/Hepatocyte Growth Factor (HGF) signaling axis. Under physiological conditions, the Met receptor tyrosine kinase and its ligand HGF are expressed at low levels in pancreatic acinar cells and the stromal compartment respectively [13–15]. Paracrine binding of HGF to Met results in receptor phosphorylation leading to increased cell survival and motility [16,17]. In contrast to lung and gastric adenocarcinomas in which activating mutations prolong Met signaling, such gain-of–function Met mutations have yet to be identified in PDAC. Normal pancreatic ducts express low Met levels. Conversely Met is over-expressed in up to 80% of PDAC cases [18], is a strong indicator for increased recurrence rates and overall poor PDAC patient survival [13,19– 22]. Met expression is present in up to 29 tumorigenic pancreatic cell lines with different genetic backgrounds, including ASPC-1, Introduction Pancreatic ductal adenocarcinoma (PDAC) is an aggressive cancer with a median patient survival rate of less than one year, making it the fourth leading cause of cancer deaths in the United States [1]. The high mortality rate of PDAC patients is due to several factors. In the absence of effective screening methods, 80– 85% of patients present with advanced disease that often precludes curative resection [2]. Furthermore, standard treatments for advanced disease are largely ineffective [3,4]. Thus there is an urgent need to understand the molecular basis of PDAC growth to identify targets of high therapeutic value. Recent genetic analysis of pancreatic tumors identified several genetic mutations common to 75–90% of patient cases important for PDAC initiation and subsequent development of preinvasive pancreatic intraepithelial neoplasms (PanINs 1–3) [5–7]. In agreement with this, genetically engineered mouse models for PDAC have confirmed the role of specific genetic mutations in the initiation and development of early stage disease. Examples are PanIN-1 (Kras activation, loss of Notch2) [8,9], PanIN-2 (loss PLoS ONE | www.plosone.org 1 July 2012 | Volume 7 | Issue 7 | e40420 Met Regulates IL-8 Secretion in Pancreatic Cancer human Met and examined their ability to knockdown Met expression. We identified two shRNA viruses (#2, Sigma NM_000245.2-3702s1c1 and #5, Sigma NM_000245.24462s1c1) that routinely resulted in reduced Met expression (not shown). BxPC-3 and ASPC-1 cells plated onto tissue culture dishes were infected with serial dilutions of lentivirus encoding MetKD shRNA-2 (59-CCGGAGACTCATAATCCAACTGTAACTCGAGTTACAGTTGGATTATGAGT CTTTTTTG-39), MetKD shRNA-5 (59-CCGGGCACTATTATAGGACTTGTATCTCGAGATACAAGTCTTATAATAGTGCTTTG-39) or NT control shRNA (59-CCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACTTAACCTTAGG-39), in the presence of 8 mg/mL hexadimethrine bromide prior to selection with 5 mg/mL puromycin for 7 days, and colonies were maintained in media containing 2.5 mg/mL puromycin for 2 months. pCDNA plasmids encoding CXCR1 and CXCR2 were a kind gift from Xavier Navarro, UTMB Galveston. Panc-1, BxPC-3 and Suit-2 cells [13,23]. One exception is the poorly differentiated MIA PaCa-2 cell line, which does not express endogenous Met [13,23]. Recently, the Met small molecule inhibitor SGX523 was reported to reduce the growth and infiltration of subcutaneous pancreatic tumors [24] raising interest in Met as a potential therapeutic target for advanced disease. However, the precise role of Met signaling for PDAC remains unresolved. In this study, we used RNA interference to reduce Met signaling in human pancreatic xenografts using an in vivo mouse orthotopic model. Met knockdown (MetKD) cells remained competent for forming orthotopic pancreatic tumors in vivo; however, the resulting MetKD xenografts were significantly growth inhibited relative to tumors resulting from control cells expressing a non targeting (NT) shRNA. Immunohistochemical analysis of MetKD xenografts showed increased cell apoptosis accompanied by reduced cell proliferation and mean vessel density (MVD in the periphery of MetKD xenografts. Consistent with this scenario, we show that Met knockdown reduces secretion of interleukin-8/ CXCL8 (IL-8), a potent pro-angiogenic chemokine that functions as a paracrine regulator of endothelial cell proliferation, an activator of neutrophils and a chemoattractant for fibroblasts and other immune cells [25]. Our finding that Met is an upstream regulator of IL-8 secretion is significant and suggests one mechanism by which Met signaling could regulate pancreatic cancer in vivo, a novel finding that may provide unique opportunities for clinical intervention. Flow Cytometry 1–26106 cells were seeded onto 10 cm tissue culture plates and following adhesion were serum-starved overnight. Flow cytometry for surface stained Met was performed using a BD FACS Array as previously described [23]. Anchorage Independent Growth Assays A bottom layer of 1% agarose diluted in media containing 1% FBS with or without 100 ng/mL HGF (PeproTech) was deposited onto 4 well tissue culture plates. After the bottom layer solidified at room temperature for 30 min, 56103 cells were resuspended in media containing 1% FBS with or without 100 ng/mL HGF and a final concentration of 0.4% agarose. The cell and agarose mixture was overlaid onto the tissue culture plates containing 1% agarose and allowed to solidify at 4uC for 10 min. Once solidified, media containing 1% FBS with or without HGF was added and cells grown for 6 weeks in a 37uC incubator with 5% CO2. Media supplemented with HGF was changed every 2–3 days. Materials and Methods Ethics Statement All animals were cared for in accordance with the Office for Protection from Research Risks (OPRR) and Animal Welfare Act guidelines under an animal protocol approved by the University of Texas M. D. Anderson Institutional Animal Care and Use Committee. This study was approved by the University of Texas M. D. Anderson Institutional Animal Care and Use Committee. Antibodies, Cell Lines, and Maintenance Cell Invasion and Migration Assays An antibody against the C-terminus of Met (C-28) was purchased from Santa Cruz Biotechnology. A mouse monoclonal antibody against b-actin was purchased from Sigma. Site-specific anti-phospho tyrosine antibodies for Met Y1234/1235 were from Upstate. An antibody specific for the extracellular domain of Met (anti-hHGFR) was purchased from R&D Systems, Inc. Antibodies against Ki67 were purchased from Abcam, cleaved caspase-3, ERK1/2, and phospho ERK1/2 T202/Y204 (pERK) antibodies, AKT and phospho AKT (S473) were from Cell Signaling. CD31 antibodies were purchased from PharMingen and recombinant human and murine HGF from PeproTech. ASPC-1, BxPC-3 and MIA PaCa-2 cells were purchased from ATCC and DNA fingerprints for each line verified by site-specific PCR (Seqwright). BxPC-3 cells were maintained in RPMI medium 1640 (Gibco) with 10% Fetal Bovine Serum (FBS) and 16 Penicillin/Streptomycin. ASPC-1 cells were maintained in Dulbecco’s modified Eagles medium (DMEM: Gibco) with 10% FBS and 16 Penicillin/Streptomycin. MIA PaCa-2 cells stably expressing exogenous wild type Met have been described elsewhere [23]. 293FT cells (Invitrogen) were co-transfected with lentiviral envelope (pMD2G), packaging (psPAX2), and shRNA plasmids directed against human Met (Sigma) to produce lentiviruses encoding the shRNA constructs. Using flow cytometry we screened four lentiviral plasmids that encoded unique shRNA sequences directed against the coding region or the 39UTR of PLoS ONE | www.plosone.org Cell migration and invasion assays were performed as previously described [26]. Wound healing assays were performed as previously described [23]. Images were captured using an ECLIPSE TE2000-U inverted microscope (Nikon) and analyzed using MetaMorph v7.3.1. (Molecular Devices). For live cell migration on collagen I, cells were serum-depleted overnight (1% FBS) and then plated onto 35 mm glass bottom tissue culture plates pre-coated with 15 mg/mL rat tail collagen I (BD Bioscience) overnight at 4uC. Cells were allowed to adhere for 1 hr before treatment with media containing 1% FBS alone or with 100 ng/mL HGF. Plates were placed in a BioStation Live Cell Imaging System (Nikon) and the chamber temperature was allowed to equilibrate for 20 min, after which images of each field were collected every 2 min for at least 2 hr. Cell migration was assessed as the total path length in micrometers traveled and cell velocity (microns/min) was determined using NIS Elements Software (AR3.10). Mice and Orthotopic Tumor Studies ASPC-1 (56105) or BxPC-3 (16106) NT, MetKD-2 or MetKD5 cell lines expressing equivalent levels of firefly luciferase, were injected in 50 mL of PBS into the body of the pancreas of 5–6 week old male athymic nude mice (NCI-Charles River) as previously described [26]. Bioluminescence imaging was conducted every 10 2 July 2012 | Volume 7 | Issue 7 | e40420 Met Regulates IL-8 Secretion in Pancreatic Cancer showed no specific staining. For the quantification of mean vessel density (MVD) in sections stained for CD31, 3 fields per tumor section were imaged using a 206objective on a Zeiss Axiovert 200 microscope and the number of discrete CD31 positive vessels per field were scored. days using a cryogenically cooled IVIS 100 imaging system coupled to a data acquisition computer running Living Image Software (Xenogen Corp) as previously described [26]. Each animal was normalized to its signal intensity at day 10 to adjust for variations in initial tumor seeding and is reported as the foldincrease in tumor volume measured as the number of photons emitted from the tumor per sec per cm2. At necropsy, primary tumors were surgically removed and weighed, and tissues either fixed with formalin for histological evaluation or flash frozen for further analysis. Angiogenesis Arrays and ELISA 36106 cells were seeded onto a 10 cm tissue culture plate and cells were allowed to adhere overnight in a 37uC humidified incubator with 5% CO2. Cells were washed in media with 1% FBS and serum-depleted overnight prior to treatment with DMEM containing 1% FBS alone (no ligand) or with 100 ng/ mL HGF for 48 hr. Conditioned media was collected and centrifuged to remove any cell debris prior to analysis. Human Angiogenesis Arrays, VEGF (R&D Systems, Inc) and human IL-8 ELISAs (BD Biosciences) were performed on conditioned media as outlined by the manufacturer. To quantify tumor VEGF and IL-8 levels, snap frozen tumor samples were processed as previously described [29]. ELISA was performed using 10 mg protein diluted in 100 mL with RIPA buffer (150 mM NaCl, 50 mM Tris-HCl pH 7.4, 0.1% SDS, 1% NP-40 (Igepal), 0.5% deoxycholic acid) containing protease (2 mg/mL Aprotinin, 2 mg/mL Pepstatin A, and 2 mg/mL Leupeptin) and phosphatase inhibitors (10 mM NaF, 2 mM Na3VO4). VEGF and IL-8 protein levels detected in xenografts by ELISA are reported as pg IL-8 or VEGF per mg protein lysate (BCA Assay, Pierce). Quantitative Reverse Transcription PCR Flash frozen xenografts were homogenized in trizol reagent (Invitrogen) and total RNA isolated according to manufactures directions. 500 ng of RNA was converted to cDNA using iScript cDNA synthesis (BioRad) with random hexamer primers. 2 mL of the cDNA was used as the template for relative quantitative real time PCR using SYBR Green PCR Master Mix (Applied Biosystems). SYBR green incorporation was measured over 40 cycles of 95uC for 30 sec, 60uC for 30 sec and 72uC for 1 min using primer sequences for Met (forward 59 TAAGTGCCCGAAGTGTAAGC -39 and reverse 59- CTTGCCATCATTGTCCAACAAAGTCCC -39) and GADPH (forward 59CAATGACCCCTTCATTGACCTC-39 and reverse 59-AGCATCGCCCCACTTGATT-39). The level of Met mRNA was determined by normalizing the CT value to the CT of human GAPDH using the comparative CT (DDCT) method as described by the manufacturers (Applied Biosystems). For studies using cell lines, cDNA was synthesized from total RNA using Accuscript (Stratagene) and PCR performed using AmpliTaq Gold PCR master mix (applied Biosystems) using the following primer sets for human CXCR1, 59-TGGGAAATGACACAGCAAAA-39 (forward) and 59-AGTGTACGCAGGGTGAATCC-39 (reverse), human CXCR2, 59-ACTTTTCCGAAGGACCGTCT-39 (forward) and 59-GTAACAGCATCCGCCAGTTT-39 (reverse), human GADPH, 59-ACGCATTTGGTCGTATTGGG-39 (forward) and 59-TGATTTTGGAGGGATCTCGC-39 (reverse) were used. Amplified products were resolved on 2% agarose gels containing ethidium bromide and imaged using an AlphaInnotech gel documentation system (AlphaInnotech). Immunohistochemistry. Orthotopic tumors were processed for immunohistochemistry as previously described [26,27] using antibodies against Met (C-28), Ki67 or cleaved caspase-3. All slides were counterstained with hematoxylin, and blinded so that scoring was performed in an unbiased manner. Proliferation and apoptosis were quantified by determining the percentage of cells that were positive for Ki67 and cleaved caspase-3 respectively. Three random fields per tumor section where imaged using a 406 objective on a Zeiss Axiovert 200 microscope with a Zeiss MRc5 color camera. The number of positively stained (CP) and negative unstained (CN) cells were counted using MetaMorph v7.3.1 (Molecular Devices). The percentage of positive staining (%P) cells was determined using the following equation: %P = (CP/ (CP+CN))*100. The percentage of necrosis (%N) was determined in H&E stained xenograft tumor specimens imaged using a 56 objective and analyzed using MetaMorph v7.3.1. The percentage of necrosis (%N) for each tumor specimen was calculated using the following equation %N = (AN/AT)*100, where AN and AT represent the necrotic and total areas respectively. CD31/platelet endothelial cell adhesion molecule 1 (PECAM-1) staining was assessed in frozen pancreatic tissues that were sectioned (8– 10 mm), mounted on positively charged slides and air-dried for 30 min and stained using CD31 antibodies as equilibrium value of MeCpG steps (,+14 deg.) [31,44]. In comparison, methylation has a significantly lower stability cost when happening at major groove positions, such as 211 and 21 base pair from dyad (mutations 9 and 12), where the roll of the nucleosome bound conformation (+10 deg.) is more compatible with the equilibrium geometry of MeCpG steps. The nucleosome destabilizing effect of cytosine methylation increases with the number of methylated cytosines, following the same position dependence as the single methylations. The multiple-methylation case reveals that each major groove meth- PLOS Computational Biology | www.ploscompbiol.org 3 November 2013 | Volume 9 | Issue 11 | e1003354 DNA Methylation and Nucleosome Positioning ylation destabilizes the nucleosome by around 1 kJ/mol (close to the average estimate of 2 kJ/mol obtained for from individual methylation studies), while each minor groove methylation destabilizes it by up to 5 kJ/mol (average free energy as single mutation is around 6 kJ/mol). This energetic position-dependence is the reverse of what was observed in a recent FRET/SAXS study [30]. The differences can be attributed to the use of different ionic conditions and different sequences: a modified Widom-601 sequence of 157 bp, which already contains multiple CpG steps in mixed orientations, and which could assume different positioning due to the introduction of new CpG steps and by effect of the methylation. The analysis of our trajectories reveals a larger root mean square deviation (RMSD) and fluctuation (RMSF; see Figures S2– S3 in Text S1) for the methylated nucleosomes, but failed to detect any systematic change in DNA geometry or in intermolecular DNA-histone energy related to methylation (Fig. S1B, S1C, S4–S6 in Text S1). The hydrophobic effect should favor orientation of the methyl group out from the solvent but this effect alone is not likely to justify the positional dependent stability changes in Figure 2, as the differential solvation of the methyl groups in the bound and unbound states is only in the order of a fraction of a water molecule (Figure S5 in Text S1). We find however, a reasonable correlation between methylation-induced changes in hydrogen bond and stacking interactions of the bases and the change in nucleosome stability (see Figure S6 in Text S1). This finding suggests that methylation-induced nucleosome destabilization is related to the poorer ability of methylated DNA to fit into the required conformation for DNA in a nucleosome. Changes in the elastic deformation energy between methylated and un-methylated DNA correlate with nucleosomal differential binding free energies To further analyze the idea that methylation-induced nucleosome destabilization is connected to a worse fit of methylated DNA into the required nucleosome-bound conformation, we computed the elastic energy of the nucleosomal DNA using a harmonic deformation method [36,37,44]. This method provides a rough estimate of the energy required to deform a DNA fiber to adopt the super helical conformation in the nucleosome (full details in Suppl. Information Text S1). As shown in Figure 2, there is an evident correlation between the increase that methylation produces in the elastic deformation energy (DDE def.) and the free energy variation (DDG bind.) computed from MD/TI calculations. Clearly, methylation increases the stiffness of the CpG step [31], raising the energy cost required to wrap DNA around the histone octamers. This extra energy cost will be smaller in regions of high positive roll (naked DNA MeCpG steps have a higher roll than CpG steps [31]) than in regions of high negative roll. Thus, simple elastic considerations explain why methylation is better tolerated when the DNA faces the histones through the major groove (where positive roll is required) that when it faces histones through the minor groove (where negative roll is required). Nucleosome methylation can give rise to nucleosome repositioning We have established that methylation affects the wrapping of DNA in nucleosomes, but how does this translate into chromatin structure? As noted above, accumulation of minor groove methylations strongly destabilizes the nucleosome, and could trigger nucleosome unfolding, or notable changes in positioning or phasing of DNA around the histone core. While accumulation of methylations might be well tolerated if placed in favorable positions, accumulation in unfavorable positions would destabilize the nucleosome, which might trigger changes in chromatin structure. Chromatin could in fact react in two different ways in response to significant levels of methylation in unfavorable positions: i) the DNA could either detach from the histone core, leading to nucleosome eviction or nucleosome repositioning, or ii) the DNA could rotate around the histone core, changing its phase to place MeCpG steps in favorable positions. Both effects are anticipated to alter DNA accessibility and impact gene expression regulation. The sub-microsecond time scale of our MD trajectories of methylated DNAs bound to nucleosomes is not large enough to capture these effects, but clear trends are visible in cases of multiple mutations occurring in unfavorable positions, where unmethylated and methylated DNA sequences are out of phase by around 28 degrees (Figure S7 in Text S1). Due to this repositioning, large or small, DNA could move and the nucleosome structure could assume a more compact and distorted conformation, as detected by Lee and Lee [29], or a slightly open conformation as found in Jimenez-Useche et al. [30]. Using the harmonic deformation method, we additionally predicted the change in stability induced by cytosine methylation for millions of different nucleosomal DNA sequences. Consistently with our calculations, we used two extreme scenarios to prepare our DNA sequences (see Fig. 3): i) all positions where the minor grooves contact the histone core are occupied by CpG steps, and ii) all positions where the major grooves contact the histone core are occupied by CpG steps. We then computed the elastic energy required to wrap the DNA around the histone proteins in unmethylated and methylated states, and, as expected, observed that methylation disfavors DNA wrapping (Figure 3A). We have rescaled the elastic energy differences with a factor of 0.23 to match the DDG prediction in figure 2B. In agreement with the rest of our results, our analysis confirms that the effect of methylation is position-dependent. In fact, the overall difference between the two extreme methylation scenarios (all-in-minor vs all-in-major) is larger than 60 kJ/mol, the average difference being around 15 kJ/ mol. We have also computed the elastic energy differences for a million sequences with CpG/MeCpG steps positioned at all possible intermediate locations with respect to the position (figure 3B). The large differences between the extreme cases can induce rotations of DNA around the histone core, shifting its phase to allow the placement of the methylated CpG steps facing the histones through the major groove. It is illustrative to compare the magnitude of CpG methylation penalty with sequence dependent differences. Since there are roughly 1.5e88 possible 147 base pairs long sequence combinations (i.e., (4n+4(n/2))/2, n = 147), it is unfeasible to calculate all the possible sequence effects. However, using our elastic model we can provide a range of values based on a reasonably large number of samples. If we consider all possible nucleosomal sequences in the yeast genome (around 12 Mbp), the energy difference between the best and the worst sequence that could form a nucleosome is 0.7 kj/mol per base (a minimum of 1 kJ/mol and maximum of around 1.7 kJ/mol per base, the first best and the last worst sequences are displayed in Table S3 in Text S1). We repeated the same calculation for one million random sequences and we obtained equivalent results. Placing one CpG step every helical turn gives an average energetic difference between minor groove and major groove methylation of 15 kJ/ mol, which translates into ,0.5 kJ/mol per methyl group, 2 kJ/ mol per base for the largest effects. Considering that not all nucleosome base pair steps are likely to be CpG steps, we can conclude that the balance between the destabilization due to CpG methylation and sequence repositioning will depend on the PLOS Computational Biology | www.ploscompbiol.org 4 November 2013 | Volume 9 | Issue 11 | e1003354 DNA Methylation and Nucleosome Positioning Figure 3. Methylated and non-methylated DNA elastic deformation energies. (A) Distribution of deformation energies for 147 bplong random DNA sequences with CpG steps positioned every 10 base steps (one helical turn) in minor (red and dark red) and major (light and dark blue) grooves respectively. The energy values were rescaled by the slope of a best-fit straight line of figure 2, which is 0.23, to por la lectura a través de la lectura de la prensa. La educación en los medios las fuerzas dispersas en función de los soportes mediáticos y orientarse más hacia la educación en medios que al dominio adquiere pleno derecho y entidad en la sección sexta titulada «competencias sociales y cívi- técnico de los aparatos. cas» que indica que «los alum- nos deberán ser capaces de juz- gar y tendrán espíritu crítico, lo que supone ser educados en los las programaciones oficiales, ya que, a lo largo de un medios y tener conciencia de su lugar y de su influencia estudio de los textos, los documentalistas del CLEMI en la sociedad». han podido señalar más de una centena de referencias a la educación de los medios en el seno de disciplinas 4. Un entorno positivo como el francés, la historia, la geografía, las lenguas, Si nos atenemos a las cifras, el panorama de la las artes plásticas : trabajos sobre las portadas de educación en medios es muy positivo. Una gran ope- prensa, reflexiones sobre temas mediáticos, análisis de ración de visibilidad como la «Semana de la prensa y publicidad, análisis de imágenes desde todos los ángu- de los medios en la escuela», coordinada por el CLE- los, reflexión sobre las noticias en los países europeos, MI, confirma año tras año, después de 17 convocato- información y opinión rias, el atractivo que ejerce sobre los profesores y los Esta presencia se constata desde la escuela mater- alumnos. Concebida como una gran operación de nal (2 a 6 años) donde, por ejemplo, se le pregunta a complementariedad entre la escuela y los profesiona- los niños más pequeños si saben diferenciar entre un les de los medios, alrededor del aprendizaje ciudada- periódico, un libro, un catálogo, a través de activida- no de la comunicación mediática, este evento moviliza des sensoriales, si saben para qué sirve un cartel, un durante toda una semana un porcentaje elevado de periódico, un cuaderno, un ordenador si son capa- centros escolares que representan un potencial de 4,3 ces de reconocer y distinguir imágenes de origen y de millones de alumnos (cifras de 2006). Basada en el naturaleza distintas. Podríamos continuar con más voluntariado, la semana permite desarrollar activida- ejemplos en todos los niveles de enseñanza y práctica- des más o menos ambiciosas centradas en la introduc- Páginas 43-48 ción de los medios en la vida de la escuela a través de la instalación de kioscos, organización de debates con profesionales y la confección por parte de los alumnos de documentos difundidos en los medios profesionales. Es la ocasión de dar un empujón a la educación en medios y de disfrutarlos. Los medios –un millar en 2006– se asocian de maneras diversas ofreciendo ejemplares de periódicos, acceso a noticias o a imágenes, proponiendo encuentros, permitiendo intervenir a los jóvenes en sus ondas o en sus columnas Esta operación da luz al trabajo de la educación en medios y moviliza a los diferentes participantes en el proyecto. 5. La formación de los docentes La formación es uno de los pilares principales de la educación en los medios. Su función es indispensable ya que no se trata de una disciplina, sino de una enseñanza que se hace sobre la base del voluntariado y del compromiso personal. Se trata de convencer, de mostrar, de interactuar. En primer lugar es necesario incluirla en la formación continua de los docentes, cuyo volumen se ha incrementado desde 1981 con la aparición de una verdadera política de formación continua de personal. Es difícil dar una imagen completa del volumen y del público, pero si nos atenemos a las cifras del CLEMI, hay más de 24.000 profesores que han asistido y se han involucrado durante 2004-05. 5.1. La formación continua En la mayoría de los casos, los profesores reciben su formación en contextos cercanos a su centro de trabajo, o incluso en este mismo. Después de una política centrada en la oferta que hacían los formadores, se valora más positivamente la demanda por parte del profesorado, ya que sólo así será verdaderamente fructífera. Los cursos de formación se repartieron en varias categorías: desde los formatos más tradicionales (cursos, debates, animaciones), hasta actividades de asesoramiento y de acompañamiento, y por supuesto los coloquios que permiten un trabajo en profundidad ya que van acompañados de expertos investigadores y profesionales. Citemos, por ejemplo en 2005, los coloquios del CLEMI-Toulouse sobre el cine documental o el del CLEMI-Dijon sobre «Políticos y medios: ¿connivencia?». Estos coloquios, que forman parte de un trabajo pedagógico regular, reagrupan a los diferentes participantes regionales y nacionales alrededor de grandes temas de la educación en medios y permiten generar nuevos conocimientos de aproximación y una profundización. Páginas 43-48 Hay otro tipo de formación original que se viene desarrollando desde hace menos tiempo, a través de cursos profesionales, como por ejemplo, en el Festival Internacional de Foto-periodismo «Visa para la imagen», en Perpignan. La formación se consolida en el curso, da acceso a las exposiciones, a las conferencias de profesionales y a los grandes debates, pero añade además propuestas pedagógicas y reflexiones didácticas destinadas a los docentes. Estas nuevas modalidades de formación son también consecuencia del agotamiento de la formación tradicional en las regiones. Los contenidos más frecuentes en formación continua conciernen tanto a los temas más clásicos como a los cambios que se están llevando a cabo en las prácticas mediáticas. Así encontramos distintas tendencias para 2004-05: La imagen desde el ángulo de la producción de imágenes animadas, el análisis de la imagen de la información o las imágenes del J.T. La prensa escrita y el periódico escolar. Internet y la información en línea. Medios y educación de los medios. 5.2 La formación inicial La formación inicial está aun en un grado muy ini- cial. El hecho de que la educación en medios no sea una disciplina impide su presencia en los IUFM (Institutos Universitarios de Formación de Maestros) que dan una prioridad absoluta a la didáctica de las disciplinas. En 2003, alrededor de 1.400 cursillistas sobre un total de 30.000 participaron en un momento u otro de un módulo de educación en medios. Estos módulos se ofrecen en función del interés que ese formador encuentra puntualmente y forman parte a menudo de varias disciplinas: documentación, letras, historia-geografía Estamos aún lejos de una política concertada en este dominio. La optativa «Cine-audiovisual» ha entrado desde hace muy poco tiempo en algunos IUFM destinada a obtener un certificado de enseñanza de la opción audiovisual y cine. Internet tiene cabida también en los cursos de formación inicial, recientemente con la aparición de un certificado informático y de Internet para los docentes, dirigido más a constatar competencias personales que a valorar una aptitud para enseñarlos. 6. ¿Y el futuro? El problema del futuro se plantea una vez más por la irrupción de nuevas técnicas y nuevos soportes. La difusión acelerada de lo digital replantea hoy muchas cuestiones relativas a prácticas mediáticas. Muchos Comunicar, 28, 2007 47 Comunicar, 28, 2007 Enrique Martínez-Salanova '2007 para Comunicar 48 trabajos que llevan el rótulo de la educación en medios solicitan una revisión ya que los conceptos cambian. La metodología elaborada en el marco de la educación en medios parece incluso permitir la inclinación de la sociedad de la información hacia una sociedad del conocimiento, como defiende la UNESCO. En Francia, se necesitaría unir las fuerzas dispersas en función de los soportes mediáticos y orientarse más hacia la educación en medios que al dominio técnico de los aparatos. Los avances recientes en el reconocimiento de estos contenidos y las competencias que supondrían podrían permitirlo. Referencias CLEMI/ACADEMIE DE BORDEAUX (Ed.) (2003): Parcours médias au collège: approches disciplinaires et transdisciplinaires. Aquitaine, Sceren-CRDP. GONNET, J. (2001): Education aux médias. Les controverses fécondes. Paris, Hachette Education/CNDP. SAVINO, J.; MARMIESSE, C. et BENSA, F. (2005): L’éducation aux médias de la maternelle au lycée. Direction de l’Enseignement Scolaire. Paris, Ministère de l’Education Nationale, Sceren/CNDP, Témoigner. BEVORT, E. et FREMONT, P. (2001): Médias, violence et education. Paris, CNDP, Actes et rapports pour l’éducation. – www.clemi.org: fiches pédagogiques, rapports et liens avec les pages régionales/académiques. – www.ac-nancy-metz.fr/cinemav/quai.html: Le site «Quai des images» est dédié à l’enseignement du cinéma et de l’audiovisuel. – www.france5.fr/education: la rubrique «Côté profs» a une entrée «education aux médias». – www.educaunet.org: Programme européen d’éducation aux risques liés à Internet. dResedfeleexliobnuetsacón Páginas 43-48
Met receptor tyrosine kinase signaling induces secretion of the angiogenic chemokine interleukin-8/CXCL8 in pancreatic cancer.
RECENT ACTIVITIES
Autor
Documento similar
Tags

Met receptor tyrosine kinase signaling induces secretion of the angiogenic chemokine interleukin-8/CXCL8 in pancreatic cancer.

Livre